ID: 1113646054

View in Genome Browser
Species Human (GRCh38)
Location 13:111996799-111996821
Sequence AGCCACCAAGGCAGCCCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113646046_1113646054 20 Left 1113646046 13:111996756-111996778 CCCCAGTGAATAGTGTACATCCT No data
Right 1113646054 13:111996799-111996821 AGCCACCAAGGCAGCCCCGGAGG No data
1113646048_1113646054 18 Left 1113646048 13:111996758-111996780 CCAGTGAATAGTGTACATCCTCC No data
Right 1113646054 13:111996799-111996821 AGCCACCAAGGCAGCCCCGGAGG No data
1113646045_1113646054 30 Left 1113646045 13:111996746-111996768 CCTGCGCAGTCCCCAGTGAATAG No data
Right 1113646054 13:111996799-111996821 AGCCACCAAGGCAGCCCCGGAGG No data
1113646047_1113646054 19 Left 1113646047 13:111996757-111996779 CCCAGTGAATAGTGTACATCCTC No data
Right 1113646054 13:111996799-111996821 AGCCACCAAGGCAGCCCCGGAGG No data
1113646049_1113646054 0 Left 1113646049 13:111996776-111996798 CCTCCCTCTTGAGTGAACACAGC No data
Right 1113646054 13:111996799-111996821 AGCCACCAAGGCAGCCCCGGAGG No data
1113646051_1113646054 -4 Left 1113646051 13:111996780-111996802 CCTCTTGAGTGAACACAGCAGCC No data
Right 1113646054 13:111996799-111996821 AGCCACCAAGGCAGCCCCGGAGG No data
1113646050_1113646054 -3 Left 1113646050 13:111996779-111996801 CCCTCTTGAGTGAACACAGCAGC No data
Right 1113646054 13:111996799-111996821 AGCCACCAAGGCAGCCCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113646054 Original CRISPR AGCCACCAAGGCAGCCCCGG AGG Intergenic