ID: 1113648128

View in Genome Browser
Species Human (GRCh38)
Location 13:112013167-112013189
Sequence GTTAGGTAACTGCCACTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113648128_1113648131 -1 Left 1113648128 13:112013167-112013189 CCTCAGAGTGGCAGTTACCTAAC No data
Right 1113648131 13:112013189-112013211 CGAAGAGGTTCTTAAAAGAAAGG No data
1113648128_1113648132 0 Left 1113648128 13:112013167-112013189 CCTCAGAGTGGCAGTTACCTAAC No data
Right 1113648132 13:112013190-112013212 GAAGAGGTTCTTAAAAGAAAGGG No data
1113648128_1113648134 20 Left 1113648128 13:112013167-112013189 CCTCAGAGTGGCAGTTACCTAAC No data
Right 1113648134 13:112013210-112013232 GGGGTCCTAATGCTTTATGTAGG No data
1113648128_1113648133 1 Left 1113648128 13:112013167-112013189 CCTCAGAGTGGCAGTTACCTAAC No data
Right 1113648133 13:112013191-112013213 AAGAGGTTCTTAAAAGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113648128 Original CRISPR GTTAGGTAACTGCCACTCTG AGG (reversed) Intergenic
No off target data available for this crispr