ID: 1113648130

View in Genome Browser
Species Human (GRCh38)
Location 13:112013184-112013206
Sequence CTTTTAAGAACCTCTTCGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113648130_1113648138 26 Left 1113648130 13:112013184-112013206 CCTAACGAAGAGGTTCTTAAAAG No data
Right 1113648138 13:112013233-112013255 ATCTATGTTATCGAGCAAAGGGG No data
1113648130_1113648137 25 Left 1113648130 13:112013184-112013206 CCTAACGAAGAGGTTCTTAAAAG No data
Right 1113648137 13:112013232-112013254 GATCTATGTTATCGAGCAAAGGG No data
1113648130_1113648134 3 Left 1113648130 13:112013184-112013206 CCTAACGAAGAGGTTCTTAAAAG No data
Right 1113648134 13:112013210-112013232 GGGGTCCTAATGCTTTATGTAGG No data
1113648130_1113648136 24 Left 1113648130 13:112013184-112013206 CCTAACGAAGAGGTTCTTAAAAG No data
Right 1113648136 13:112013231-112013253 GGATCTATGTTATCGAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113648130 Original CRISPR CTTTTAAGAACCTCTTCGTT AGG (reversed) Intergenic
No off target data available for this crispr