ID: 1113648134

View in Genome Browser
Species Human (GRCh38)
Location 13:112013210-112013232
Sequence GGGGTCCTAATGCTTTATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113648128_1113648134 20 Left 1113648128 13:112013167-112013189 CCTCAGAGTGGCAGTTACCTAAC No data
Right 1113648134 13:112013210-112013232 GGGGTCCTAATGCTTTATGTAGG No data
1113648130_1113648134 3 Left 1113648130 13:112013184-112013206 CCTAACGAAGAGGTTCTTAAAAG No data
Right 1113648134 13:112013210-112013232 GGGGTCCTAATGCTTTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113648134 Original CRISPR GGGGTCCTAATGCTTTATGT AGG Intergenic
No off target data available for this crispr