ID: 1113649236

View in Genome Browser
Species Human (GRCh38)
Location 13:112023741-112023763
Sequence GACTCACAGTTCCACGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22098
Summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113649232_1113649236 7 Left 1113649232 13:112023711-112023733 CCCGGCTACTTTTAGAAAAGAGG No data
Right 1113649236 13:112023741-112023763 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083
1113649230_1113649236 15 Left 1113649230 13:112023703-112023725 CCACCACACCCGGCTACTTTTAG No data
Right 1113649236 13:112023741-112023763 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083
1113649234_1113649236 6 Left 1113649234 13:112023712-112023734 CCGGCTACTTTTAGAAAAGAGGT No data
Right 1113649236 13:112023741-112023763 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083
1113649231_1113649236 12 Left 1113649231 13:112023706-112023728 CCACACCCGGCTACTTTTAGAAA No data
Right 1113649236 13:112023741-112023763 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083
1113649229_1113649236 19 Left 1113649229 13:112023699-112023721 CCGACCACCACACCCGGCTACTT 0: 32
1: 2346
2: 19105
3: 58175
4: 88766
Right 1113649236 13:112023741-112023763 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113649236 Original CRISPR GACTCACAGTTCCACGTGAC TGG Intergenic
Too many off-targets to display for this crispr