ID: 1113649826

View in Genome Browser
Species Human (GRCh38)
Location 13:112027421-112027443
Sequence CCCAGAAGTCGGGTGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113649811_1113649826 14 Left 1113649811 13:112027384-112027406 CCAGGAGTCGGGTGGGGACAGGC No data
Right 1113649826 13:112027421-112027443 CCCAGAAGTCGGGTGGGGACAGG No data
1113649805_1113649826 22 Left 1113649805 13:112027376-112027398 CCAGGATCCCAGGAGTCGGGTGG No data
Right 1113649826 13:112027421-112027443 CCCAGAAGTCGGGTGGGGACAGG No data
1113649809_1113649826 15 Left 1113649809 13:112027383-112027405 CCCAGGAGTCGGGTGGGGACAGG No data
Right 1113649826 13:112027421-112027443 CCCAGAAGTCGGGTGGGGACAGG No data
1113649804_1113649826 23 Left 1113649804 13:112027375-112027397 CCCAGGATCCCAGGAGTCGGGTG No data
Right 1113649826 13:112027421-112027443 CCCAGAAGTCGGGTGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113649826 Original CRISPR CCCAGAAGTCGGGTGGGGAC AGG Intergenic
No off target data available for this crispr