ID: 1113651052

View in Genome Browser
Species Human (GRCh38)
Location 13:112034506-112034528
Sequence AATCCCAGGCTCTTACCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113651043_1113651052 1 Left 1113651043 13:112034482-112034504 CCTGCGCTCTCCAAATCCCACGG No data
Right 1113651052 13:112034506-112034528 AATCCCAGGCTCTTACCTAGGGG No data
1113651046_1113651052 -9 Left 1113651046 13:112034492-112034514 CCAAATCCCACGGGAATCCCAGG No data
Right 1113651052 13:112034506-112034528 AATCCCAGGCTCTTACCTAGGGG No data
1113651041_1113651052 13 Left 1113651041 13:112034470-112034492 CCGTGCCTCATGCCTGCGCTCTC No data
Right 1113651052 13:112034506-112034528 AATCCCAGGCTCTTACCTAGGGG No data
1113651042_1113651052 8 Left 1113651042 13:112034475-112034497 CCTCATGCCTGCGCTCTCCAAAT No data
Right 1113651052 13:112034506-112034528 AATCCCAGGCTCTTACCTAGGGG No data
1113651040_1113651052 14 Left 1113651040 13:112034469-112034491 CCCGTGCCTCATGCCTGCGCTCT No data
Right 1113651052 13:112034506-112034528 AATCCCAGGCTCTTACCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113651052 Original CRISPR AATCCCAGGCTCTTACCTAG GGG Intergenic
No off target data available for this crispr