ID: 1113651159

View in Genome Browser
Species Human (GRCh38)
Location 13:112035143-112035165
Sequence CCTTCCTTGCAGGGTCTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113651148_1113651159 11 Left 1113651148 13:112035109-112035131 CCCTTAAGGCCTGTCTGATGAGG No data
Right 1113651159 13:112035143-112035165 CCTTCCTTGCAGGGTCTCAGGGG No data
1113651152_1113651159 2 Left 1113651152 13:112035118-112035140 CCTGTCTGATGAGGGCTCCGCAT No data
Right 1113651159 13:112035143-112035165 CCTTCCTTGCAGGGTCTCAGGGG No data
1113651150_1113651159 10 Left 1113651150 13:112035110-112035132 CCTTAAGGCCTGTCTGATGAGGG No data
Right 1113651159 13:112035143-112035165 CCTTCCTTGCAGGGTCTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113651159 Original CRISPR CCTTCCTTGCAGGGTCTCAG GGG Intergenic
No off target data available for this crispr