ID: 1113651694

View in Genome Browser
Species Human (GRCh38)
Location 13:112037760-112037782
Sequence GGGGCTCTTTCATGAGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113651688_1113651694 17 Left 1113651688 13:112037720-112037742 CCGTCGTCGTTTCTGTCTGGGAA No data
Right 1113651694 13:112037760-112037782 GGGGCTCTTTCATGAGTTGAGGG No data
1113651687_1113651694 18 Left 1113651687 13:112037719-112037741 CCCGTCGTCGTTTCTGTCTGGGA No data
Right 1113651694 13:112037760-112037782 GGGGCTCTTTCATGAGTTGAGGG No data
1113651685_1113651694 19 Left 1113651685 13:112037718-112037740 CCCCGTCGTCGTTTCTGTCTGGG No data
Right 1113651694 13:112037760-112037782 GGGGCTCTTTCATGAGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113651694 Original CRISPR GGGGCTCTTTCATGAGTTGA GGG Intergenic
No off target data available for this crispr