ID: 1113652235

View in Genome Browser
Species Human (GRCh38)
Location 13:112042172-112042194
Sequence TGCCCAGAAGAGTCCCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113652227_1113652235 16 Left 1113652227 13:112042133-112042155 CCACTGCTGCCAGAGGCTGGGAA No data
Right 1113652235 13:112042172-112042194 TGCCCAGAAGAGTCCCAGAGAGG No data
1113652230_1113652235 7 Left 1113652230 13:112042142-112042164 CCAGAGGCTGGGAAGGTCAAGGG No data
Right 1113652235 13:112042172-112042194 TGCCCAGAAGAGTCCCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113652235 Original CRISPR TGCCCAGAAGAGTCCCAGAG AGG Intergenic
No off target data available for this crispr