ID: 1113653353

View in Genome Browser
Species Human (GRCh38)
Location 13:112053676-112053698
Sequence GGCACCGGAGGCGGCCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113653353_1113653359 -7 Left 1113653353 13:112053676-112053698 CCCCAGGGGCCGCCTCCGGTGCC No data
Right 1113653359 13:112053692-112053714 CGGTGCCTAAACAAAGAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113653353 Original CRISPR GGCACCGGAGGCGGCCCCTG GGG (reversed) Intergenic
No off target data available for this crispr