ID: 1113653782

View in Genome Browser
Species Human (GRCh38)
Location 13:112056042-112056064
Sequence ACCCGCGCCGGTCCCCGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113653782_1113653797 23 Left 1113653782 13:112056042-112056064 CCAGCGCGGGGACCGGCGCGGGT No data
Right 1113653797 13:112056088-112056110 AACCCCAGGGAAGGACCGGGTGG No data
1113653782_1113653795 19 Left 1113653782 13:112056042-112056064 CCAGCGCGGGGACCGGCGCGGGT No data
Right 1113653795 13:112056084-112056106 GGAAAACCCCAGGGAAGGACCGG No data
1113653782_1113653791 -2 Left 1113653782 13:112056042-112056064 CCAGCGCGGGGACCGGCGCGGGT No data
Right 1113653791 13:112056063-112056085 GTGGGAGTGGGGGCGCGGCGCGG No data
1113653782_1113653794 14 Left 1113653782 13:112056042-112056064 CCAGCGCGGGGACCGGCGCGGGT No data
Right 1113653794 13:112056079-112056101 GGCGCGGAAAACCCCAGGGAAGG No data
1113653782_1113653790 -7 Left 1113653782 13:112056042-112056064 CCAGCGCGGGGACCGGCGCGGGT No data
Right 1113653790 13:112056058-112056080 CGCGGGTGGGAGTGGGGGCGCGG No data
1113653782_1113653796 20 Left 1113653782 13:112056042-112056064 CCAGCGCGGGGACCGGCGCGGGT No data
Right 1113653796 13:112056085-112056107 GAAAACCCCAGGGAAGGACCGGG No data
1113653782_1113653802 30 Left 1113653782 13:112056042-112056064 CCAGCGCGGGGACCGGCGCGGGT No data
Right 1113653802 13:112056095-112056117 GGGAAGGACCGGGTGGACACGGG No data
1113653782_1113653801 29 Left 1113653782 13:112056042-112056064 CCAGCGCGGGGACCGGCGCGGGT No data
Right 1113653801 13:112056094-112056116 AGGGAAGGACCGGGTGGACACGG No data
1113653782_1113653792 9 Left 1113653782 13:112056042-112056064 CCAGCGCGGGGACCGGCGCGGGT No data
Right 1113653792 13:112056074-112056096 GGCGCGGCGCGGAAAACCCCAGG No data
1113653782_1113653793 10 Left 1113653782 13:112056042-112056064 CCAGCGCGGGGACCGGCGCGGGT No data
Right 1113653793 13:112056075-112056097 GCGCGGCGCGGAAAACCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113653782 Original CRISPR ACCCGCGCCGGTCCCCGCGC TGG (reversed) Intergenic