ID: 1113653789

View in Genome Browser
Species Human (GRCh38)
Location 13:112056054-112056076
Sequence GCCCCCACTCCCACCCGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113653789_1113653797 11 Left 1113653789 13:112056054-112056076 CCGGCGCGGGTGGGAGTGGGGGC No data
Right 1113653797 13:112056088-112056110 AACCCCAGGGAAGGACCGGGTGG No data
1113653789_1113653804 23 Left 1113653789 13:112056054-112056076 CCGGCGCGGGTGGGAGTGGGGGC No data
Right 1113653804 13:112056100-112056122 GGACCGGGTGGACACGGGACGGG No data
1113653789_1113653793 -2 Left 1113653789 13:112056054-112056076 CCGGCGCGGGTGGGAGTGGGGGC No data
Right 1113653793 13:112056075-112056097 GCGCGGCGCGGAAAACCCCAGGG No data
1113653789_1113653795 7 Left 1113653789 13:112056054-112056076 CCGGCGCGGGTGGGAGTGGGGGC No data
Right 1113653795 13:112056084-112056106 GGAAAACCCCAGGGAAGGACCGG No data
1113653789_1113653806 26 Left 1113653789 13:112056054-112056076 CCGGCGCGGGTGGGAGTGGGGGC No data
Right 1113653806 13:112056103-112056125 CCGGGTGGACACGGGACGGGAGG No data
1113653789_1113653801 17 Left 1113653789 13:112056054-112056076 CCGGCGCGGGTGGGAGTGGGGGC No data
Right 1113653801 13:112056094-112056116 AGGGAAGGACCGGGTGGACACGG No data
1113653789_1113653809 29 Left 1113653789 13:112056054-112056076 CCGGCGCGGGTGGGAGTGGGGGC No data
Right 1113653809 13:112056106-112056128 GGTGGACACGGGACGGGAGGGGG No data
1113653789_1113653794 2 Left 1113653789 13:112056054-112056076 CCGGCGCGGGTGGGAGTGGGGGC No data
Right 1113653794 13:112056079-112056101 GGCGCGGAAAACCCCAGGGAAGG No data
1113653789_1113653792 -3 Left 1113653789 13:112056054-112056076 CCGGCGCGGGTGGGAGTGGGGGC No data
Right 1113653792 13:112056074-112056096 GGCGCGGCGCGGAAAACCCCAGG No data
1113653789_1113653807 27 Left 1113653789 13:112056054-112056076 CCGGCGCGGGTGGGAGTGGGGGC No data
Right 1113653807 13:112056104-112056126 CGGGTGGACACGGGACGGGAGGG No data
1113653789_1113653803 22 Left 1113653789 13:112056054-112056076 CCGGCGCGGGTGGGAGTGGGGGC No data
Right 1113653803 13:112056099-112056121 AGGACCGGGTGGACACGGGACGG No data
1113653789_1113653810 30 Left 1113653789 13:112056054-112056076 CCGGCGCGGGTGGGAGTGGGGGC No data
Right 1113653810 13:112056107-112056129 GTGGACACGGGACGGGAGGGGGG No data
1113653789_1113653796 8 Left 1113653789 13:112056054-112056076 CCGGCGCGGGTGGGAGTGGGGGC No data
Right 1113653796 13:112056085-112056107 GAAAACCCCAGGGAAGGACCGGG No data
1113653789_1113653802 18 Left 1113653789 13:112056054-112056076 CCGGCGCGGGTGGGAGTGGGGGC No data
Right 1113653802 13:112056095-112056117 GGGAAGGACCGGGTGGACACGGG No data
1113653789_1113653808 28 Left 1113653789 13:112056054-112056076 CCGGCGCGGGTGGGAGTGGGGGC No data
Right 1113653808 13:112056105-112056127 GGGTGGACACGGGACGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113653789 Original CRISPR GCCCCCACTCCCACCCGCGC CGG (reversed) Intergenic