ID: 1113653794

View in Genome Browser
Species Human (GRCh38)
Location 13:112056079-112056101
Sequence GGCGCGGAAAACCCCAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113653782_1113653794 14 Left 1113653782 13:112056042-112056064 CCAGCGCGGGGACCGGCGCGGGT No data
Right 1113653794 13:112056079-112056101 GGCGCGGAAAACCCCAGGGAAGG No data
1113653789_1113653794 2 Left 1113653789 13:112056054-112056076 CCGGCGCGGGTGGGAGTGGGGGC No data
Right 1113653794 13:112056079-112056101 GGCGCGGAAAACCCCAGGGAAGG No data
1113653780_1113653794 15 Left 1113653780 13:112056041-112056063 CCCAGCGCGGGGACCGGCGCGGG No data
Right 1113653794 13:112056079-112056101 GGCGCGGAAAACCCCAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113653794 Original CRISPR GGCGCGGAAAACCCCAGGGA AGG Intergenic