ID: 1113654206

View in Genome Browser
Species Human (GRCh38)
Location 13:112057938-112057960
Sequence AGCGGGCGGCTCCGCGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113654206_1113654218 19 Left 1113654206 13:112057938-112057960 CCAGCGCCGCGGAGCCGCCCGCT No data
Right 1113654218 13:112057980-112058002 GGTTTGAGCCTCCCGTGGAGAGG No data
1113654206_1113654219 24 Left 1113654206 13:112057938-112057960 CCAGCGCCGCGGAGCCGCCCGCT No data
Right 1113654219 13:112057985-112058007 GAGCCTCCCGTGGAGAGGAAAGG No data
1113654206_1113654212 -2 Left 1113654206 13:112057938-112057960 CCAGCGCCGCGGAGCCGCCCGCT No data
Right 1113654212 13:112057959-112057981 CTTCCGCTCCCTCTTTCCGCGGG No data
1113654206_1113654217 14 Left 1113654206 13:112057938-112057960 CCAGCGCCGCGGAGCCGCCCGCT No data
Right 1113654217 13:112057975-112057997 CCGCGGGTTTGAGCCTCCCGTGG No data
1113654206_1113654211 -3 Left 1113654206 13:112057938-112057960 CCAGCGCCGCGGAGCCGCCCGCT No data
Right 1113654211 13:112057958-112057980 GCTTCCGCTCCCTCTTTCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113654206 Original CRISPR AGCGGGCGGCTCCGCGGCGC TGG (reversed) Intergenic
No off target data available for this crispr