ID: 1113655607

View in Genome Browser
Species Human (GRCh38)
Location 13:112066661-112066683
Sequence GCGCGCGCGCGCGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1416
Summary {0: 1, 1: 4, 2: 27, 3: 240, 4: 1144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113655607_1113655615 11 Left 1113655607 13:112066661-112066683 CCGCCGCCGCCGCGCGCGCGCGC 0: 1
1: 4
2: 27
3: 240
4: 1144
Right 1113655615 13:112066695-112066717 TGTGGCTGTCACCCCCTCCCGGG 0: 1
1: 0
2: 2
3: 39
4: 342
1113655607_1113655614 10 Left 1113655607 13:112066661-112066683 CCGCCGCCGCCGCGCGCGCGCGC 0: 1
1: 4
2: 27
3: 240
4: 1144
Right 1113655614 13:112066694-112066716 GTGTGGCTGTCACCCCCTCCCGG 0: 1
1: 0
2: 1
3: 23
4: 249
1113655607_1113655613 -7 Left 1113655607 13:112066661-112066683 CCGCCGCCGCCGCGCGCGCGCGC 0: 1
1: 4
2: 27
3: 240
4: 1144
Right 1113655613 13:112066677-112066699 CGCGCGCTCAGGAAGCGGTGTGG 0: 1
1: 0
2: 0
3: 3
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113655607 Original CRISPR GCGCGCGCGCGCGGCGGCGG CGG (reversed) Intergenic