ID: 1113655915

View in Genome Browser
Species Human (GRCh38)
Location 13:112067735-112067757
Sequence GCCCCCGCCGCCGCCCGCCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1694
Summary {0: 2, 1: 12, 2: 71, 3: 284, 4: 1325}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113655915_1113655925 0 Left 1113655915 13:112067735-112067757 CCGGGGCGGGCGGCGGCGGGGGC 0: 2
1: 12
2: 71
3: 284
4: 1325
Right 1113655925 13:112067758-112067780 GGAGGCGGGGGCGGCGGCGGCGG 0: 4
1: 102
2: 1706
3: 3057
4: 7460
1113655915_1113655926 3 Left 1113655915 13:112067735-112067757 CCGGGGCGGGCGGCGGCGGGGGC 0: 2
1: 12
2: 71
3: 284
4: 1325
Right 1113655926 13:112067761-112067783 GGCGGGGGCGGCGGCGGCGGCGG 0: 17
1: 1204
2: 1931
3: 3625
4: 7930
1113655915_1113655930 14 Left 1113655915 13:112067735-112067757 CCGGGGCGGGCGGCGGCGGGGGC 0: 2
1: 12
2: 71
3: 284
4: 1325
Right 1113655930 13:112067772-112067794 CGGCGGCGGCGGGGGCGCCAAGG 0: 1
1: 4
2: 47
3: 387
4: 1234
1113655915_1113655928 5 Left 1113655915 13:112067735-112067757 CCGGGGCGGGCGGCGGCGGGGGC 0: 2
1: 12
2: 71
3: 284
4: 1325
Right 1113655928 13:112067763-112067785 CGGGGGCGGCGGCGGCGGCGGGG 0: 4
1: 146
2: 441
3: 1065
4: 3249
1113655915_1113655924 -3 Left 1113655915 13:112067735-112067757 CCGGGGCGGGCGGCGGCGGGGGC 0: 2
1: 12
2: 71
3: 284
4: 1325
Right 1113655924 13:112067755-112067777 GGCGGAGGCGGGGGCGGCGGCGG 0: 1
1: 52
2: 1551
3: 2846
4: 6929
1113655915_1113655933 29 Left 1113655915 13:112067735-112067757 CCGGGGCGGGCGGCGGCGGGGGC 0: 2
1: 12
2: 71
3: 284
4: 1325
Right 1113655933 13:112067787-112067809 CGCCAAGGCCAACCAGGACCGGG 0: 1
1: 0
2: 0
3: 10
4: 130
1113655915_1113655922 -9 Left 1113655915 13:112067735-112067757 CCGGGGCGGGCGGCGGCGGGGGC 0: 2
1: 12
2: 71
3: 284
4: 1325
Right 1113655922 13:112067749-112067771 GGCGGGGGCGGAGGCGGGGGCGG 0: 4
1: 121
2: 358
3: 2794
4: 8863
1113655915_1113655931 23 Left 1113655915 13:112067735-112067757 CCGGGGCGGGCGGCGGCGGGGGC 0: 2
1: 12
2: 71
3: 284
4: 1325
Right 1113655931 13:112067781-112067803 CGGGGGCGCCAAGGCCAACCAGG 0: 1
1: 0
2: 0
3: 6
4: 131
1113655915_1113655932 28 Left 1113655915 13:112067735-112067757 CCGGGGCGGGCGGCGGCGGGGGC 0: 2
1: 12
2: 71
3: 284
4: 1325
Right 1113655932 13:112067786-112067808 GCGCCAAGGCCAACCAGGACCGG 0: 1
1: 0
2: 0
3: 6
4: 81
1113655915_1113655929 6 Left 1113655915 13:112067735-112067757 CCGGGGCGGGCGGCGGCGGGGGC 0: 2
1: 12
2: 71
3: 284
4: 1325
Right 1113655929 13:112067764-112067786 GGGGGCGGCGGCGGCGGCGGGGG 0: 20
1: 1327
2: 2180
3: 3732
4: 7807
1113655915_1113655923 -6 Left 1113655915 13:112067735-112067757 CCGGGGCGGGCGGCGGCGGGGGC 0: 2
1: 12
2: 71
3: 284
4: 1325
Right 1113655923 13:112067752-112067774 GGGGGCGGAGGCGGGGGCGGCGG 0: 3
1: 113
2: 370
3: 2945
4: 9325
1113655915_1113655927 4 Left 1113655915 13:112067735-112067757 CCGGGGCGGGCGGCGGCGGGGGC 0: 2
1: 12
2: 71
3: 284
4: 1325
Right 1113655927 13:112067762-112067784 GCGGGGGCGGCGGCGGCGGCGGG 0: 4
1: 230
2: 518
3: 1265
4: 3503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113655915 Original CRISPR GCCCCCGCCGCCGCCCGCCC CGG (reversed) Exonic