ID: 1113656064

View in Genome Browser
Species Human (GRCh38)
Location 13:112068348-112068370
Sequence CGTGCGGGTGGTGCGGGTGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 325}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113656064_1113656075 19 Left 1113656064 13:112068348-112068370 CCCGCACCCGCACCACCCGCACG 0: 1
1: 0
2: 0
3: 38
4: 325
Right 1113656075 13:112068390-112068412 GCCCATGCACCGCTACGACATGG 0: 1
1: 1
2: 0
3: 2
4: 24
1113656064_1113656077 20 Left 1113656064 13:112068348-112068370 CCCGCACCCGCACCACCCGCACG 0: 1
1: 0
2: 0
3: 38
4: 325
Right 1113656077 13:112068391-112068413 CCCATGCACCGCTACGACATGGG 0: 1
1: 0
2: 0
3: 3
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113656064 Original CRISPR CGTGCGGGTGGTGCGGGTGC GGG (reversed) Exonic
900178129 1:1299633-1299655 CGTGTGGGTGGGGCCGCTGCTGG - Intronic
900496373 1:2977836-2977858 GGTGTGGATGGTGGGGGTGCTGG + Intergenic
901055119 1:6445753-6445775 GGTGGGGGTGGTGGGGGTGTGGG - Exonic
901275819 1:7990231-7990253 GGTGAGGGTGGTGAGGGTGATGG - Intergenic
901448570 1:9322860-9322882 CGGGCGGGTGGGGTGGGTGCGGG - Intronic
901682403 1:10921239-10921261 AGTGCGGGTGGTGAGGTTGGAGG - Intergenic
901897561 1:12327470-12327492 GGTGGGGGTGGTGGGGGTGGGGG - Intronic
903206022 1:21783118-21783140 CGTGCGGGTCGGGCGCGGGCGGG - Exonic
904585799 1:31579875-31579897 AGTGGGGGTGGAGTGGGTGCAGG - Intronic
907047048 1:51305785-51305807 GGTGGGGGTGGTGTGGGCGCTGG - Intronic
910863338 1:91764614-91764636 TGTGTGGGTGGTTCGGGTGGAGG + Intronic
912500763 1:110120595-110120617 GGTGAGGGTGGTGCCGGTGATGG - Intergenic
915513654 1:156400674-156400696 GGTGCGGGGGGCGCGGGGGCTGG + Intergenic
915755643 1:158256877-158256899 CGTGTGGGTGATGTGGATGCGGG + Exonic
915762529 1:158329535-158329557 CGTGTGGGTGATGTGGATGCGGG - Exonic
915765272 1:158355918-158355940 CGTGTGGGTGATGTGGATGCGGG + Exonic
920879188 1:209864383-209864405 TGTGTGGGTGGTGGGGGTGGGGG + Intergenic
921168285 1:212523255-212523277 TTGGCGGGTGGTGAGGGTGCTGG + Intergenic
924367168 1:243307258-243307280 GGTGGGGGTGGTGTGGGTGTGGG - Intronic
1063379760 10:5577086-5577108 GGTGCGGGGTGTGCGTGTGCGGG - Intergenic
1063379771 10:5577131-5577153 CGTGCGGGGTGTGTGTGTGCGGG - Intergenic
1063379808 10:5577311-5577333 TGTGCGGGGTGTGCGTGTGCAGG - Intergenic
1063379840 10:5577458-5577480 TGTGCGGGGTGTGTGGGTGCGGG - Intergenic
1063379845 10:5577473-5577495 TGTGCGGGGTGTGCGTGTGCGGG - Intergenic
1063379862 10:5577567-5577589 TGTGCGGGGTGTGTGGGTGCGGG - Intergenic
1064381240 10:14843485-14843507 GCTGCGGTTGGTGCTGGTGCAGG - Intronic
1066094251 10:32057156-32057178 CGTGGGGGCGGCGAGGGTGCGGG - Intergenic
1067554831 10:47261554-47261576 GGTGGGGGTGGGGCGGGAGCGGG - Intergenic
1067557446 10:47282755-47282777 CTTGGGGGTGGTGGGGGTGCGGG - Intergenic
1073048013 10:100651694-100651716 CGTGGAGGTGGTGGGGGTGGTGG - Intergenic
1073048030 10:100651739-100651761 CGTGGAGGTGGTGGGGGTGGTGG - Intergenic
1073048047 10:100651784-100651806 CGTGGAGGTGGTGGGGGTGGTGG - Intergenic
1073048064 10:100651829-100651851 CGTGGAGGTGGTGGGGGTGGTGG - Intergenic
1073048081 10:100651874-100651896 CGTGGAGGTGGTGGGGGTGGTGG - Intergenic
1073048098 10:100651919-100651941 CGTGGAGGTGGTGGGGGTGGTGG - Intergenic
1074088728 10:110227292-110227314 CGTGTGGGAGGGGCGGGTGCGGG + Intronic
1075725780 10:124610364-124610386 GGTGCTGGTGGAGCGGGTGAGGG + Intronic
1075725790 10:124610397-124610419 GGTGCTGGTGGAGCGGGTGAGGG + Intronic
1075725835 10:124610562-124610584 GGTGCTGGTGGAGCGGGTGCGGG + Intronic
1075725864 10:124610667-124610689 GGTGCTGGTGGAGCGGGTGCGGG + Intronic
1075725949 10:124610976-124610998 GGTGCTGGTGGAGCGGGTGAGGG + Intronic
1075725960 10:124611024-124611046 GGTGCTGATGGAGCGGGTGCGGG + Intronic
1077110641 11:860596-860618 GGTGGGGGTGGGGCGGCTGCTGG + Intronic
1077405842 11:2382212-2382234 TGTGCGGGGGGTGGGGGTGGGGG - Intronic
1077919179 11:6630524-6630546 CGCGCGGCTGCTGCGAGTGCAGG - Exonic
1079122588 11:17696138-17696160 TGTGCGCGGGGTGCGGCTGCGGG + Intergenic
1083307897 11:61770350-61770372 GGTGGGGGTGGTGGGGGTGGCGG - Exonic
1083780460 11:64914883-64914905 CTTGGGGGTGGTGAGGGGGCTGG + Intronic
1083933277 11:65857576-65857598 CGCCCGGGAGGGGCGGGTGCTGG - Intronic
1084310224 11:68312508-68312530 GGTGCGGGGGGCGCGGGTGGCGG + Intergenic
1084952020 11:72671615-72671637 ACTGCGGGGGGTGGGGGTGCAGG + Intronic
1086361848 11:86068598-86068620 CGCGCGGGTCGCGCGGGCGCCGG + Intronic
1087014525 11:93542937-93542959 CGGGCGGGAAGTGCGGGTGCGGG - Intronic
1088606832 11:111540882-111540904 CGTGCTGCTGGTGGGGCTGCGGG + Exonic
1090832866 11:130431262-130431284 GGTGGGGGTGGTGGGGGTGGTGG - Intergenic
1091546502 12:1504662-1504684 GGTGCAGGTGAGGCGGGTGCGGG - Intergenic
1094240820 12:28222299-28222321 GGTGGTGGTGGTGCTGGTGCTGG + Intronic
1095753012 12:45730467-45730489 CGGGCGGGCGGCGCGGGAGCGGG - Intronic
1096860592 12:54524827-54524849 GGTGCTGGTGGTGCTGGTGGTGG + Intronic
1097267547 12:57755040-57755062 CGGGCGGGCGGGGCGGGCGCCGG - Intronic
1103520877 12:121536559-121536581 CGTGGGGGTGGGGTGGGTGAGGG - Intronic
1103870227 12:124085915-124085937 CCTGAGGGAGGTGCGGGAGCTGG + Intronic
1104912412 12:132245638-132245660 CGGGCTGGGGGTGTGGGTGCTGG - Intronic
1104935479 12:132361915-132361937 CGGGCCGCTGGTGCGGGTGATGG - Intergenic
1104935519 12:132362132-132362154 CGGGCCGCTGGTGCGGGTGATGG - Intergenic
1104935529 12:132362186-132362208 CGGGCCGCTGGTGCGGGTGATGG - Intergenic
1104935539 12:132362240-132362262 CGGGCCGCTGGTGCGGGTGATGG - Intergenic
1104935559 12:132362347-132362369 CGGGCCGCTGGTGCGGGTGATGG - Intergenic
1104935569 12:132362401-132362423 CGGGCCGCTGGTGCGGGTGATGG - Intergenic
1104935579 12:132362455-132362477 CGGGCCGCTGGTGCGGGTGATGG - Intergenic
1104935589 12:132362509-132362531 CGGGCCGCTGGTGCGGGTGATGG - Intergenic
1104935599 12:132362563-132362585 CGGGCCGCTGGTGCGGGTGATGG - Intergenic
1105000355 12:132686875-132686897 CGCGCGGCTGGGGAGGGTGCGGG - Intronic
1112343401 13:98570936-98570958 CTTGTGGGTGGTGTGAGTGCAGG - Intronic
1112505072 13:99970547-99970569 GGTGGGGGTGGTGCTGGTGCGGG + Exonic
1113602975 13:111584235-111584257 CCTCAGGGTGGGGCGGGTGCTGG - Intergenic
1113656059 13:112068327-112068349 GGTGCGCGGGGTGCGCGTGCGGG - Exonic
1113656064 13:112068348-112068370 CGTGCGGGTGGTGCGGGTGCGGG - Exonic
1113956277 13:114101350-114101372 CGTGGGGGTGCAGGGGGTGCTGG - Intronic
1114259539 14:21026511-21026533 ATTGCGGGTGGTGAGGGTGGTGG - Intronic
1121144309 14:91570282-91570304 GGTGCGGGGGGTGGGGGTGAGGG + Intergenic
1122145115 14:99684277-99684299 CGAGCGGGCGGGGAGGGTGCTGG + Intergenic
1122151097 14:99726701-99726723 CAGGGGGGTGGTGGGGGTGCGGG - Exonic
1122275001 14:100586866-100586888 CGGGCGGGTGGCGAGGGTGCGGG - Intronic
1122411362 14:101527683-101527705 CGGGCGGGGGGTGGGGGTGCTGG + Intergenic
1123491171 15:20783818-20783840 AGAGCGGGTTGTGCGGGCGCTGG - Intergenic
1123547673 15:21352909-21352931 AGAGCGGGTTGTGCGGGCGCTGG - Intergenic
1126009524 15:44289077-44289099 CGTGCTGGTGGTGCTGCTGGTGG + Exonic
1126392936 15:48178411-48178433 GGTGCGGGGGGTGGGAGTGCGGG + Exonic
1126469471 15:48992604-48992626 AGTGCTGGTGGTGCTGGTGATGG + Exonic
1126849679 15:52789476-52789498 GGTGCGGGTGGTGGTGGTGATGG + Exonic
1128227056 15:66009335-66009357 CATGGGGGTGGGGAGGGTGCAGG + Intronic
1128302507 15:66575401-66575423 CCTGGGGTTGGTGCGGGTGGAGG + Intergenic
1128758085 15:70196609-70196631 CCAGCGGGTGCTGCTGGTGCTGG - Intergenic
1128801930 15:70502487-70502509 CGTGAGGTTGGTGTGGGCGCTGG - Intergenic
1128989857 15:72250800-72250822 AGTGGGGGTGGTGAGGGGGCGGG - Intronic
1131955493 15:97730939-97730961 TGTGTGGTTGGTGGGGGTGCTGG - Intergenic
1202956003 15_KI270727v1_random:80139-80161 AGAGCGGGTTGTGCGGGCGCTGG - Intergenic
1132557497 16:579002-579024 CGTTCGAGTGGGGCGGGGGCGGG + Intronic
1132803429 16:1765065-1765087 CTTGCTGGTGGTCAGGGTGCTGG - Exonic
1132832043 16:1933192-1933214 GGGGCGCGTGGGGCGGGTGCTGG - Intergenic
1134554650 16:15154828-15154850 GGTGGGGGCGGGGCGGGTGCAGG + Intergenic
1135782933 16:25322033-25322055 CGGGGGGGTGGTGAGGGTGGAGG + Intergenic
1136016948 16:27406401-27406423 GGAGTGGGGGGTGCGGGTGCTGG + Intronic
1136500186 16:30666262-30666284 GCTGCGGGTGGTGAGGGGGCAGG - Intronic
1136512790 16:30749105-30749127 GCTGCTGGTGGTGCTGGTGCTGG + Intronic
1136512794 16:30749120-30749142 GGTGCTGGTGGTGGTGGTGCTGG + Intronic
1136512795 16:30749126-30749148 GGTGGTGGTGGTGCTGGTGCTGG + Intronic
1136512802 16:30749153-30749175 GGTGCTGGTGGTGGTGGTGCTGG + Intronic
1136512816 16:30749230-30749252 GGTGGTGGTGGTGCTGGTGCTGG + Intronic
1136512820 16:30749245-30749267 GGTGCTGGTGGTGCTGGTGGTGG + Intronic
1136893581 16:33983977-33983999 CGTGAGGGTGGTGGGCCTGCGGG + Intergenic
1139364800 16:66426972-66426994 GGGGCGGGGGGCGCGGGTGCGGG - Intergenic
1139473153 16:67188989-67189011 GGGGCAGGGGGTGCGGGTGCTGG - Intronic
1140927566 16:79599146-79599168 CGGCGGCGTGGTGCGGGTGCAGG + Exonic
1141832677 16:86518406-86518428 CTTGCAGGTGGGGCGGGAGCTGG + Intergenic
1142009833 16:87708312-87708334 CTGGCGGGTGGCGCGGCTGCTGG - Intronic
1142267347 16:89070719-89070741 AGCGGGGGTGGTGAGGGTGCTGG - Intergenic
1142408947 16:89906553-89906575 TGAGCGCGTGGTGCGGCTGCTGG + Intronic
1203079453 16_KI270728v1_random:1139645-1139667 CGTGAGGGTGGTGGGCCTGCGGG - Intergenic
1142737237 17:1908695-1908717 CGGGCGGGGGGTGGGGGTCCAGG - Intergenic
1142983022 17:3682212-3682234 GGTCCGGGTGGTGCGGGGTCGGG - Intronic
1143863972 17:9910731-9910753 CAGGGGGGTGGTGCGGGGGCAGG + Intronic
1146265364 17:31449297-31449319 GGTGCGGGTGCTGTGGGTGAGGG - Intronic
1147371818 17:39997694-39997716 CGTGCAGGGGGTGGGGGTGCTGG + Exonic
1148657473 17:49298553-49298575 GGTGTGGGTGGTGAGGGTGTGGG + Exonic
1149441561 17:56678611-56678633 CGTGCTGCTGGTGCGAGCGCCGG + Intergenic
1149496029 17:57118082-57118104 GGTGGGGGTGGTGCTGCTGCTGG + Intronic
1149997048 17:61411007-61411029 CGCGGGAGGGGTGCGGGTGCGGG + Intergenic
1150070676 17:62147552-62147574 CGCGGGGGTGGGGGGGGTGCGGG - Intergenic
1150230934 17:63550179-63550201 AGTGCGGGTGGTGGGGGCGTGGG - Intergenic
1151681673 17:75625822-75625844 TCTGCGGGTGGAGAGGGTGCAGG - Intergenic
1152361328 17:79834471-79834493 GGTGATGGGGGTGCGGGTGCGGG + Exonic
1152361333 17:79834486-79834508 GGTGCGGGTGGTGTGAGGGCGGG + Exonic
1152607663 17:81301132-81301154 CGTGTGTGTGGTGCGTGTGTGGG + Intergenic
1152637803 17:81437308-81437330 AGTGCAGGTGGTGCCAGTGCCGG - Intronic
1152695365 17:81741303-81741325 GGTGCGGGAGCTGCGGGTCCTGG - Intergenic
1152755141 17:82084080-82084102 CGCGCTGGTGGTGCGTGGGCGGG - Exonic
1152843348 17:82584462-82584484 TTTGCGGGGGGTGGGGGTGCGGG - Intronic
1156008439 18:32470465-32470487 GGCGCGGGTGGTGCCGGTGGCGG - Intronic
1160441795 18:78898802-78898824 CGTGGGGGTGGTGGAGGTCCTGG + Intergenic
1160441817 18:78898931-78898953 CGTGGGGGTGGTGCAGGCCCTGG + Intergenic
1160630923 18:80246483-80246505 CGTGGGGGTGGTCTGGGTACGGG + Intronic
1160726407 19:619708-619730 CATGCGGGTGGCACAGGTGCTGG - Exonic
1161005699 19:1935147-1935169 CCTGCGGTTGGTGGGGGTGAGGG + Intergenic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1161807984 19:6456147-6456169 CGTGTGGGGGTTGCGGGTACAGG - Intronic
1162133869 19:8543731-8543753 GGTGCTGGTGGTGCTGGTGGTGG + Intronic
1162133880 19:8543773-8543795 GGTGCTGGTGGTGCTGGTGGTGG + Intronic
1162133882 19:8543782-8543804 GGTGCTGGTGGTGGTGGTGCTGG + Intronic
1162133886 19:8543797-8543819 GGTGCTGGTGGTGCTGGTGGTGG + Intronic
1162133905 19:8543863-8543885 GGTGCTGGTGGTGCTGGTGGTGG + Intronic
1162133926 19:8543935-8543957 GGTGCTGGTGGTGCTGGTGGTGG + Intronic
1162133932 19:8543959-8543981 GGTGGTGGTGGTGCTGGTGCTGG + Intronic
1163219311 19:15903068-15903090 CATGCGGGTGGCACAGGTGCTGG - Intergenic
1163635573 19:18435735-18435757 CGTGCGTGGGGCGCGGGCGCGGG - Exonic
1163777060 19:19224955-19224977 CCTGCGGGAGGGGCGGGTGGAGG - Exonic
1165080039 19:33301820-33301842 CGGGCGGCGGGTGCGGGTGCGGG + Exonic
1165715086 19:38039391-38039413 GGTGGGGGTGGTGGGGGTGGGGG + Intronic
1166301297 19:41913426-41913448 CGTCCGGGTGGGGCGGGTGTGGG - Intronic
1166346065 19:42166695-42166717 CGTGAGGGAGATGAGGGTGCAGG + Intronic
1166385190 19:42376677-42376699 TGTGGGGGTGGTGGGGGTGCTGG + Exonic
1166547007 19:43639828-43639850 GGCGCGGGCGGTGCAGGTGCCGG - Exonic
1167574127 19:50309648-50309670 CGTGCGGGTGGTGAAGGTGAGGG - Exonic
1168076389 19:53982742-53982764 GGCGCGGGTGGCGCGGGCGCGGG - Exonic
1168102415 19:54148283-54148305 CTTGGGGGTGCTGCGGGGGCGGG - Exonic
1168305560 19:55433332-55433354 CGTGGTGGTGGTGGGCGTGCAGG + Exonic
1168602306 19:57727642-57727664 CCTGCGGGGGGTGCGTGGGCGGG - Intronic
925165020 2:1710660-1710682 GGTGCTGGTAGAGCGGGTGCTGG - Intronic
925165029 2:1710707-1710729 GGTGCTGGTGGAGTGGGTGCTGG - Intronic
925165033 2:1710722-1710744 GGTGCTGGTGGAGAGGGTGCTGG - Intronic
925165037 2:1710737-1710759 GGTGCTGGTGGAGTGGGTGCTGG - Intronic
925165041 2:1710752-1710774 GGTGCTGGTGGAGTGGGTGCTGG - Intronic
925165049 2:1710784-1710806 GGTGCTGGTGGAGTGGGTGCTGG - Intronic
925165053 2:1710799-1710821 GGTGCTGGTGGAGTGGGTGCTGG - Intronic
925165061 2:1710831-1710853 GGTGCTGGTGGAGTGGGTGCTGG - Intronic
925165065 2:1710846-1710868 GGTGCTGGTGGAGTGGGTGCTGG - Intronic
925165073 2:1710878-1710900 GGTGCTGGTGGAGCAGGTGCTGG - Intronic
925165080 2:1710910-1710932 GGTGCTGGTGGAGTGGGTGCTGG - Intronic
925165094 2:1710972-1710994 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165098 2:1710987-1711009 GGTGCTGGTGGAGTGGGTGCTGG - Intronic
925165112 2:1711049-1711071 GGTGCTTGTGGAGCGGGTGCTGG - Intronic
925165134 2:1711147-1711169 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165142 2:1711179-1711201 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165146 2:1711194-1711216 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165160 2:1711256-1711278 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165172 2:1711305-1711327 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165176 2:1711320-1711342 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165184 2:1711352-1711374 GATGCTGGTGGAGCGGGTGCTGG - Intronic
925165190 2:1711382-1711404 GGTGCTTGTGGAGCGGGTGCTGG - Intronic
925165208 2:1711463-1711485 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165212 2:1711478-1711500 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165234 2:1711574-1711596 GGTGCTGGTGGAGTGGGTGCTGG - Intronic
925165246 2:1711623-1711645 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165250 2:1711638-1711660 GGTGCTGGTGGAGTGGGTGCTGG - Intronic
925730594 2:6917507-6917529 CGTGCGGGCTGCGCGGGCGCGGG + Exonic
925984856 2:9207172-9207194 CGTGCGGGTGGTGAAGCTGGAGG - Exonic
926150405 2:10422747-10422769 TGGGAGGGTGGTGAGGGTGCTGG - Intronic
926702153 2:15810897-15810919 GGGGTGGGTGGTGGGGGTGCTGG - Intergenic
927710848 2:25324992-25325014 AGTGCTGGTGGTGCCAGTGCTGG - Intronic
927710851 2:25325007-25325029 CCTGCTGGTGGTGCCAGTGCTGG - Intronic
931436775 2:62254423-62254445 TGTGTGGGTGTTGGGGGTGCGGG - Intergenic
932452659 2:71824303-71824325 CGTGTGTGTGGTGCTGGTGATGG - Intergenic
933811073 2:86033094-86033116 CCTGAGGGTGGTGTGGGAGCAGG - Intronic
936947937 2:117947397-117947419 CGTGGGGGTGATGCGTGTTCTGG - Intronic
937231467 2:120400508-120400530 CGTGTGGGTGGCGCGGGTTTGGG + Intergenic
939550896 2:143614119-143614141 AGTGAGGGTGGTGCAGGAGCTGG - Intronic
940005094 2:149003074-149003096 CGTGTGGGTGGTGAGAGTGAGGG - Intronic
940778663 2:157910318-157910340 CGTGGAGGTGGTGGGGGAGCAGG + Intronic
941905896 2:170716108-170716130 CGTGCGTGGGGTGCGGTGGCGGG + Intronic
942042645 2:172081167-172081189 CGTGCGTGTGGGGTGGGTGGGGG - Exonic
943585109 2:189729707-189729729 TGTGTGTGTGGTGCGGGTGGGGG + Intronic
944414309 2:199467754-199467776 CGTGGTGGTGGTGAGGGGGCTGG - Intronic
946419574 2:219557421-219557443 CAGGCAGGTGCTGCGGGTGCAGG - Exonic
946471965 2:219968989-219969011 CGTGTGGGAGGTGAGGGGGCAGG - Intergenic
948707828 2:239806203-239806225 CGTGAGGGTGGTGCTGCAGCTGG - Intergenic
948746123 2:240095571-240095593 GGTGCAGGAGCTGCGGGTGCAGG + Intergenic
948746191 2:240095795-240095817 GGTGCAGGAGCTGCGGGTGCTGG + Intergenic
1169006057 20:2207848-2207870 GGTGCGCGTGGGGCGGGGGCTGG - Intergenic
1172046902 20:32086814-32086836 CGTGCTGGGGCTGGGGGTGCAGG + Intronic
1172313611 20:33936475-33936497 CGTGGGGGTGGGGGGGGCGCGGG + Intergenic
1173166130 20:40688415-40688437 GGTACGCGTGGTGCGGGTGAGGG + Exonic
1173548127 20:43914737-43914759 CGCGCGGGCGGGGCGGGGGCGGG + Intergenic
1175304489 20:57966550-57966572 CGTGCTGGGAGTGGGGGTGCAGG - Intergenic
1175749208 20:61483662-61483684 GGGGCGGGGGGGGCGGGTGCTGG - Intronic
1176125275 20:63472270-63472292 CGCGCGGGCGGCGCGGGCGCCGG - Exonic
1177696950 21:24585524-24585546 CGTGGGGGTGGGGAGGGTGGGGG - Intergenic
1178707828 21:34889554-34889576 TGTCCGGCTGCTGCGGGTGCCGG - Intronic
1179405338 21:41121219-41121241 AATGCGGGTGGTGCGGGGGAGGG - Intergenic
1179430408 21:41317245-41317267 CGGGTGGGGGGTGGGGGTGCGGG - Intronic
1179718424 21:43301937-43301959 CATGAGGGTGGTGGGGGTGCAGG + Intergenic
1179784060 21:43719708-43719730 CGGGCGGGCGGTGCGGCTCCCGG + Intronic
1180614807 22:17120320-17120342 CGTGGTGGTGGTGCAGGTGGTGG + Exonic
1180614981 22:17120963-17120985 CCCGCGGCTGGTGCTGGTGCTGG + Exonic
1181277768 22:21697258-21697280 GGTGCGGGTGGTGGGGATGAAGG + Exonic
1182549641 22:31093845-31093867 GCTGCGGGTGGTGCCGGTGGAGG - Intronic
1182638754 22:31750192-31750214 CGCGCGCGCGGTGCGGGGGCGGG - Intergenic
1183349117 22:37324912-37324934 CGCCCGGGTGGCGCGGGAGCGGG - Intergenic
1183820878 22:40345156-40345178 AGTGCAGGTGGAGAGGGTGCAGG + Intergenic
1183850889 22:40586902-40586924 GGTGCTGCTGGTGCTGGTGCTGG + Intronic
1184353444 22:43960926-43960948 TGTGCGGGTGGAGCGGGTGGTGG + Intronic
1184651888 22:45923179-45923201 CGTGCAGGTGGAGGTGGTGCGGG - Exonic
1185384120 22:50523958-50523980 GGTGCAGGTGGTGCGGCAGCTGG - Exonic
949923826 3:9024957-9024979 AGTGGTGGTGGTGCTGGTGCTGG + Intronic
950448152 3:13050049-13050071 GGGGCGGGGGGTGGGGGTGCAGG - Intronic
951823144 3:26836544-26836566 GGTGCTGGTGGTGGAGGTGCTGG + Intergenic
952430459 3:33218673-33218695 CGGGCGGATGGTGAGTGTGCGGG - Exonic
953439767 3:42907287-42907309 GTTGCGGGTGGTGGGGGTGCAGG + Intronic
954138075 3:48591426-48591448 AGTGTGTGTGGTGGGGGTGCTGG + Intronic
954396775 3:50297191-50297213 CAGGCGGGAGGTGCGGCTGCGGG + Exonic
955747396 3:62153875-62153897 AGTGCTGGGGGTGCTGGTGCAGG + Intronic
956120854 3:65964515-65964537 CTTGGGGGTAGTGCGGGGGCGGG + Intronic
956295663 3:67710604-67710626 CCTCTGGGTGGTGCTGGTGCTGG + Intergenic
960576977 3:119240090-119240112 CGTGGCGGTGGTGAGGGTACTGG - Intronic
961384626 3:126516609-126516631 GGGGCAGGTGGAGCGGGTGCTGG - Intronic
961534781 3:127563735-127563757 GGTGCTGGTGGTGGTGGTGCTGG - Intergenic
964451529 3:156817142-156817164 CGGGCGGGAGGTGCAGGTGCTGG + Intergenic
966851944 3:184170136-184170158 GGTGCGGGTTGTATGGGTGCGGG - Exonic
967250885 3:187536855-187536877 GGTCTGGGTGGTGCGGGTGGTGG + Intergenic
967377952 3:188826660-188826682 CATGCTGGTGGTGCTGGTGTGGG - Intronic
967685199 3:192409627-192409649 CGCTCGGGTGGGGCGGGGGCTGG + Intronic
968563279 4:1296073-1296095 CGTGAAGGTGGTGCAGGAGCAGG - Intronic
968563336 4:1296274-1296296 CGTGAAGGTGGTGCAGGAGCAGG - Intronic
968674726 4:1871367-1871389 CGGGCGGGAGGCGCGGGGGCGGG + Intergenic
968698444 4:2043594-2043616 CCTGCGGGTGGTGTGGGAGCTGG + Intronic
969716993 4:8872599-8872621 GGAGCGGGCGGTGGGGGTGCTGG - Intergenic
970202855 4:13627448-13627470 GGGGCGGGCGGCGCGGGTGCGGG - Exonic
975281751 4:72569445-72569467 GGTGCGGGGGGCGCGGGTTCGGG - Intergenic
976629179 4:87219979-87220001 GGTGCGGCTGGCGCGGGTTCGGG - Intronic
977666923 4:99653317-99653339 CGTCCGGGTGGTGTTGGTGCTGG + Exonic
978072408 4:104490561-104490583 AGTGCAGCTGGTGCGGGTGGTGG + Intronic
978962605 4:114701714-114701736 CGTGGGGGAGGTGCTGGTGGTGG + Intergenic
979530543 4:121765175-121765197 AGTGCGGGAGGTGGGTGTGCGGG - Exonic
982209021 4:153020191-153020213 CGTGTGGGTGGAGCATGTGCTGG - Intergenic
985705873 5:1401077-1401099 AGGGCTGGTGGTGAGGGTGCTGG - Intronic
986456772 5:7927680-7927702 CGTGGGGGTGGCGCTGGTGGCGG + Intergenic
987078195 5:14403507-14403529 GGTGGTGGTGGTGAGGGTGCAGG + Intronic
987078202 5:14403540-14403562 GGTGCAGGTTGTGAGGGTGCAGG + Intronic
987078268 5:14403807-14403829 GGTGCAGGTTGTGAGGGTGCAGG + Intronic
987078300 5:14403921-14403943 GGTGGTGGTGGTGAGGGTGCAGG + Intronic
987078311 5:14403969-14403991 GGTACAGGTGGTGAGGGTGCAGG + Intronic
987258147 5:16179071-16179093 TGGGCTGGTGGTGCTGGTGCTGG + Exonic
987594230 5:19974827-19974849 GGTGCAGGGGGTGTGGGTGCTGG + Intronic
988809145 5:34767595-34767617 GGTGGGGGTGGTGGGGGTGGTGG - Intronic
989207376 5:38824476-38824498 GGTGCTGGTGGTGCTGGTGCTGG - Intergenic
989207380 5:38824497-38824519 GGTGGTGGTGGTGCTGGTGCTGG - Intergenic
995650386 5:114362283-114362305 GGTGCGCGAGGTGCGGGTGGTGG - Exonic
997513202 5:134466816-134466838 CCTGTGGGAGGTGCCGGTGCTGG + Intergenic
998444333 5:142187018-142187040 CGGGAGGGCGGTGCGGGTGGGGG - Intergenic
998507831 5:142686298-142686320 CCTGCGGGTGGTGTGGGAGTGGG - Intronic
1002581013 5:180209374-180209396 CGAGCGGGTGGTCCTGGCGCGGG - Intergenic
1003047932 6:2752083-2752105 CGTGGTGGTGGTCCGGGTGGAGG - Intergenic
1006379972 6:33691719-33691741 GGTGAGGGTGGTGTGTGTGCAGG + Exonic
1006956667 6:37879355-37879377 GGAGCGGGTGGTGGTGGTGCAGG + Intronic
1007410043 6:41656328-41656350 TGTGTGTGTGGTGCGGGTGATGG - Intergenic
1007711104 6:43824880-43824902 GGTGGGGGGGGTGCGGGTACTGG + Intergenic
1007924639 6:45641415-45641437 CGTGCTGGTGGTCCGGGAGCTGG + Intronic
1011128940 6:84034487-84034509 CGGGCGGGGGGAGCGGGGGCGGG - Intronic
1011344162 6:86350731-86350753 TGTGTGTGTGGTGCGGGTGGTGG - Intergenic
1012399525 6:98832718-98832740 TGCGCGCGTGGTGGGGGTGCAGG + Intergenic
1017684789 6:156901444-156901466 GGTGCGGGGGCTGCGGCTGCTGG - Exonic
1017911183 6:158794312-158794334 GGTGGTGGTGGTGCTGGTGCTGG - Intronic
1019310036 7:355638-355660 GGTGCTGGTGGTGCTGGTGGTGG - Intergenic
1019487289 7:1295232-1295254 TGTGTGTGTGGTGTGGGTGCAGG + Intergenic
1019487355 7:1295542-1295564 TGTGTGTGTGGTGTGGGTGCAGG + Intergenic
1021653601 7:22854150-22854172 CCCGCGGGCGGGGCGGGTGCTGG + Intergenic
1021704325 7:23351756-23351778 TGTGTGGGTGGTGGTGGTGCGGG - Intronic
1021719257 7:23490461-23490483 CGGGCGGGTGGTGTGGGCGCCGG + Intergenic
1023038527 7:36153288-36153310 CGTGCGGCTGGTGCTGGGTCTGG + Exonic
1023872944 7:44272518-44272540 CTTGCGGGTGGTGGAGCTGCTGG - Intronic
1027264112 7:76484546-76484568 GGTGCGGGTGGTGAGGGAGTGGG + Intronic
1027315481 7:76982660-76982682 GGTGCGGGTGGTGAGGGAGTGGG + Intergenic
1028985582 7:97006244-97006266 CGTGGTGGTGGTGCTGGTGGTGG - Exonic
1032408868 7:131678237-131678259 CCTGTGGGTGGTGTGTGTGCAGG + Intergenic
1036133341 8:6136550-6136572 GGTGCGGGTGGTGGTGGTGGGGG - Intergenic
1040734783 8:50491883-50491905 CCTGCGGGTGGTAGGGGGGCGGG - Intronic
1040897836 8:52387942-52387964 CGGGGGGGTGGGGAGGGTGCTGG - Intronic
1041108007 8:54459713-54459735 CCGGGGGGTGGTGCTGGTGCTGG - Exonic
1041712952 8:60910106-60910128 CGGGCGGGCGGAGAGGGTGCGGG - Intergenic
1047807233 8:128373171-128373193 GGTGCTGCTGGTGCAGGTGCTGG + Intergenic
1047807271 8:128373522-128373544 GGTGCCAGTGGTGCTGGTGCTGG + Intergenic
1049290061 8:141797142-141797164 GGAGAGGGTGGTGGGGGTGCGGG + Intergenic
1049421714 8:142519530-142519552 GGTGGGGGTGGTGCTGCTGCTGG + Intronic
1049421732 8:142519623-142519645 GGTGGTGGTGGTGCTGGTGCTGG + Intronic
1049421745 8:142519701-142519723 GGTGTTGGTGGTGCTGGTGCTGG + Intronic
1049665591 8:143841247-143841269 CGCGGGGGTGGGGCGGGTCCTGG - Intergenic
1049673100 8:143878351-143878373 GGTGCGGCGGGTGCGGGTGCGGG - Intronic
1049673102 8:143878357-143878379 CGGGCAGGTGCGGCGGGTGCGGG - Intronic
1049673108 8:143878376-143878398 CGGGCAGGTGCGGCGGGTGCGGG - Intronic
1049767057 8:144359732-144359754 CATCCGGGTGGTGCAGGTGCTGG + Exonic
1049784680 8:144444647-144444669 CGTGCGGGAGGAGCTGGGGCGGG + Intergenic
1052413138 9:28147674-28147696 CGTGGGGCTGTTGGGGGTGCGGG - Intronic
1057186334 9:93059195-93059217 CGGGCGGGTGGCGCGGGGGCGGG + Intronic
1057277243 9:93682384-93682406 CCTGGGGCTGGGGCGGGTGCTGG + Intergenic
1059436255 9:114278327-114278349 GGTGATGGTGGTGCTGGTGCTGG + Intronic
1060662291 9:125411412-125411434 GGAGCGGGAGGTGCAGGTGCAGG - Intergenic
1061481068 9:130897979-130898001 CGTGAGGGTGGTGGGGCTGGTGG + Intergenic
1061582340 9:131545760-131545782 GGTGCTGGCGGAGCGGGTGCTGG + Intergenic
1061582363 9:131545830-131545852 GGTGCTGGTGGGGCGGGTGCTGG + Intergenic
1061693705 9:132355263-132355285 CCTGCGGGTGGGGCGGCTCCGGG + Intergenic
1061931736 9:133836353-133836375 CGAGGGGCTGGTGCGGGAGCGGG - Intronic
1062269392 9:135701704-135701726 CCTGCGGGGGGTGTGGGGGCGGG + Intergenic
1062362097 9:136193074-136193096 GGAGCGGGAGGTGCGGGGGCAGG - Intergenic
1062636539 9:137494527-137494549 GGTGAGGGTGGTGCGGGTGAGGG - Intronic
1062689924 9:137836341-137836363 CGTGCACGTGGTGCGAATGCGGG + Intronic
1203767980 EBV:36417-36439 GGTGGGGGTGGTGGGGGTGGTGG - Intergenic
1203767985 EBV:36426-36448 GGTGGGGGTGGTGGGGGTGGTGG - Intergenic
1203767990 EBV:36435-36457 GGTGGGGGTGGTGGGGGTGGTGG - Intergenic
1203767995 EBV:36444-36466 GGTGGGGGTGGTGGGGGTGGTGG - Intergenic
1190303124 X:49067736-49067758 AGTGCGGGTGGCACGGGTGTGGG - Exonic
1191024011 X:55894121-55894143 GGTGGTGGTGGTGAGGGTGCAGG - Intergenic
1192962504 X:76145352-76145374 CGTGGTGGTGGGGGGGGTGCTGG + Intergenic
1192963029 X:76149735-76149757 CGTGGTGGTGGGGGGGGTGCTGG - Intergenic
1195068561 X:101258687-101258709 CCTGCGGTTGGTGGGGGGGCGGG + Intronic
1195284100 X:103366704-103366726 CGTGGGGGTGGTGGGGGAACAGG - Intergenic
1196439738 X:115707660-115707682 TGTGGGGGTGGGGCTGGTGCCGG + Intergenic
1197873543 X:131082378-131082400 CGGGAGGGCGGTGCGGGCGCGGG + Intronic
1198155221 X:133953265-133953287 GGTGGGGGTGGTGTGGGTGTGGG - Intronic
1200000145 X:153056120-153056142 CGTGCGGGAGGGGCAGGAGCCGG + Intergenic
1200064204 X:153497022-153497044 CCTGTGGGTGGGGCGTGTGCTGG - Intronic
1200126289 X:153816399-153816421 CCTGTGGGTGGGGCGTGTGCTGG + Intronic
1200235299 X:154465131-154465153 TGAGTGCGTGGTGCGGGTGCAGG + Exonic
1200714406 Y:6520785-6520807 CGTTCGGGTGGGGCTGGAGCTGG + Intergenic
1201019417 Y:9640371-9640393 CGTTCGGGTGGGGCTGGAGCTGG - Intergenic