ID: 1113656165

View in Genome Browser
Species Human (GRCh38)
Location 13:112068737-112068759
Sequence CAGCGGCCGCGGCGCAGAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 284}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113656155_1113656165 11 Left 1113656155 13:112068703-112068725 CCCGCCGGCGAGGGGGGCGACCC 0: 1
1: 0
2: 1
3: 9
4: 105
Right 1113656165 13:112068737-112068759 CAGCGGCCGCGGCGCAGAGCCGG 0: 1
1: 0
2: 0
3: 36
4: 284
1113656158_1113656165 7 Left 1113656158 13:112068707-112068729 CCGGCGAGGGGGGCGACCCGGCG 0: 1
1: 0
2: 1
3: 11
4: 83
Right 1113656165 13:112068737-112068759 CAGCGGCCGCGGCGCAGAGCCGG 0: 1
1: 0
2: 0
3: 36
4: 284
1113656162_1113656165 -9 Left 1113656162 13:112068723-112068745 CCCGGCGGCGGCAGCAGCGGCCG 0: 1
1: 8
2: 16
3: 183
4: 625
Right 1113656165 13:112068737-112068759 CAGCGGCCGCGGCGCAGAGCCGG 0: 1
1: 0
2: 0
3: 36
4: 284
1113656163_1113656165 -10 Left 1113656163 13:112068724-112068746 CCGGCGGCGGCAGCAGCGGCCGC 0: 1
1: 9
2: 24
3: 206
4: 953
Right 1113656165 13:112068737-112068759 CAGCGGCCGCGGCGCAGAGCCGG 0: 1
1: 0
2: 0
3: 36
4: 284
1113656156_1113656165 10 Left 1113656156 13:112068704-112068726 CCGCCGGCGAGGGGGGCGACCCG 0: 1
1: 0
2: 1
3: 2
4: 92
Right 1113656165 13:112068737-112068759 CAGCGGCCGCGGCGCAGAGCCGG 0: 1
1: 0
2: 0
3: 36
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113656165 Original CRISPR CAGCGGCCGCGGCGCAGAGC CGG Exonic
900349282 1:2227315-2227337 CACCGGCCACGGCGCAGCGGGGG + Intergenic
900596401 1:3482042-3482064 CAGCGGCCGCCTCGCAGGGCGGG + Intergenic
900626536 1:3611158-3611180 CAGGGGCCGCGGCGGAACGCTGG + Exonic
901086213 1:6613789-6613811 CGGCGGCGGCGGCGGTGAGCGGG - Exonic
901207158 1:7503858-7503880 CAGCGGAGGTGGCTCAGAGCCGG - Intronic
901436060 1:9248120-9248142 AAGCGGCCGCGGGGATGAGCTGG - Intronic
901443533 1:9293310-9293332 CAGCGGCGGCAGCGCGGGGCGGG - Intronic
902636154 1:17736323-17736345 CAGCCCCCGAGGGGCAGAGCTGG + Intergenic
902783126 1:18717029-18717051 CGGCGGCGGCGGCGGAGCGCGGG - Intronic
902823233 1:18956221-18956243 CGGCGGCGGCGGGGCAGGGCCGG - Exonic
903822114 1:26111177-26111199 CGGCGGCGGCGGCGCGGGGCTGG - Intronic
903907460 1:26696676-26696698 CGGCGGGCCCGGCGCGGAGCCGG + Exonic
903976796 1:27155205-27155227 CAGGGGCCGCTGCGCTGGGCGGG - Intronic
904401244 1:30258046-30258068 CAGGGGCGGAGGCTCAGAGCTGG + Intergenic
905449324 1:38046756-38046778 CGGCGGCGGCGGCGCGGCGCAGG - Exonic
907410581 1:54280717-54280739 CAGAGGAGGCGGCGCAGAGAGGG + Intronic
908184727 1:61641860-61641882 CGGCGGCCGCCGCAGAGAGCAGG + Intergenic
908355845 1:63324099-63324121 CAGCGGCCGCGGCGGCGCCCAGG - Exonic
908714285 1:67053743-67053765 CGGCGGCGGCGGCGCGGCGCCGG - Intronic
911316166 1:96359176-96359198 CAGCCTCCTGGGCGCAGAGCAGG + Intergenic
912670430 1:111619826-111619848 CTGCTGTCGCCGCGCAGAGCCGG + Exonic
913100896 1:115564388-115564410 CAGCGGCGGCGGCGGCGATCAGG - Intergenic
915165697 1:153946642-153946664 CGGCGCCCGCGGCCCGGAGCGGG - Exonic
915517489 1:156421653-156421675 CAGCGGGCGCCGGGCAGAGGAGG + Intronic
916052412 1:161045617-161045639 CGGCGGCTGCGGCGCGCAGCTGG + Intronic
916588308 1:166166632-166166654 CAGCGGCGGCGGCATGGAGCCGG + Exonic
917974615 1:180230707-180230729 TGGCGGCCGGGGCGCAGAGGCGG + Intronic
921029821 1:211327124-211327146 CAGCGGGAGCGGTGCGGAGCGGG + Intronic
922440614 1:225652914-225652936 GAGAGGCCGAGGCGCGGAGCTGG + Exonic
922898517 1:229118944-229118966 CAGAGGCCACTGAGCAGAGCAGG - Intergenic
923144782 1:231190439-231190461 CAGTGGCTGTGGCCCAGAGCTGG - Intronic
1063104527 10:2981473-2981495 CAGAGGGCACAGCGCAGAGCAGG + Intergenic
1063298158 10:4826630-4826652 CTGCGGCCGCGGCGTTGGGCGGG + Intronic
1064380463 10:14837774-14837796 CAGCTGCTGCGCCGCAGCGCGGG + Intronic
1064981939 10:21174068-21174090 CAGAGCCAGCGGCGCGGAGCCGG - Intronic
1065021918 10:21508709-21508731 CAGGGTCTGCGGGGCAGAGCAGG - Intergenic
1065025314 10:21534890-21534912 CCGCGGCCGCGGCACGGGGCGGG - Intronic
1065099607 10:22320855-22320877 GAGCGGCGGCCGCGCGGAGCAGG + Intronic
1065506842 10:26438206-26438228 CAGGGGACGCGGTGCAGGGCTGG - Exonic
1066022744 10:31319464-31319486 GAGCGGCCGCGGCGCGGCTCCGG - Intronic
1066429326 10:35336836-35336858 CGGCGGCGGCGGCGACGAGCGGG - Intronic
1066752733 10:38675672-38675694 CAGCAGCAGCAGCACAGAGCAGG - Intergenic
1067558620 10:47289173-47289195 CAGCGGCCCTGGGGAAGAGCAGG + Intergenic
1070311388 10:75276253-75276275 CAGCGGCTGCTGCGCGGCGCAGG + Intergenic
1070800843 10:79243571-79243593 CCGCCGCCGGGGCGCGGAGCGGG + Intronic
1070912784 10:80132798-80132820 AAGAGCCCGCGGCGCGGAGCAGG - Exonic
1072757557 10:98030835-98030857 CAGTGGCCGCCGCGCCGCGCCGG - Intergenic
1074056079 10:109923645-109923667 CAGCGCCTGCGGCCCAGAGCGGG + Intergenic
1074377435 10:112951435-112951457 CAGCGGCGGCCGCGCGGAGCGGG - Intronic
1074591858 10:114821684-114821706 TAGCGGCCCCGCCGCAGGGCAGG + Intergenic
1075438312 10:122461117-122461139 CAGGGGCCTCTGCGCAGACCCGG - Intergenic
1077170045 11:1162078-1162100 CAGCGGCCCCCACGCTGAGCAGG + Exonic
1077517799 11:3012346-3012368 CAGTGGCCGCGACACAGGGCAGG + Intronic
1077518021 11:3013894-3013916 CAGCGGCCACGACACAGGGCAGG + Intronic
1078729521 11:13962871-13962893 CTGCGGCCGCGGCACAAAGTTGG + Exonic
1079126232 11:17720312-17720334 CAGCGGGCCCGGCGCATAGAAGG - Exonic
1080458843 11:32436690-32436712 CAGCCCCCGCGCCCCAGAGCAGG + Intergenic
1081713668 11:45233862-45233884 CAGCAGCTGCTGCGCGGAGCGGG - Intronic
1084153224 11:67300852-67300874 CAGCGGCATCTGAGCAGAGCAGG + Intronic
1085640287 11:78188923-78188945 CCGGGGCCGCGCCGCAGAGTCGG + Exonic
1090884129 11:130861458-130861480 CAGAGGCCGCGCGGCAGTGCTGG - Intergenic
1091550199 12:1530726-1530748 CCGCGGCCGGGGCGCGGGGCTGG - Intronic
1095752792 12:45729657-45729679 CGGCGGCGGCGGCGCAGGGAGGG - Exonic
1096682806 12:53268228-53268250 CAGCGGGCGCGGCGCAACGCCGG - Intergenic
1100469057 12:94873833-94873855 CTGCGGCGGAGGCGCGGAGCCGG + Intergenic
1102386888 12:112517405-112517427 TAGCGTCCCCGGCCCAGAGCAGG + Intergenic
1102520680 12:113476062-113476084 CCGCCGCCGCCGCGCAGACCCGG - Intergenic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1103377553 12:120469059-120469081 AAGCGGCCGCGGGGCAGCGCGGG - Intronic
1103400642 12:120640906-120640928 CGGCGGCGGCGGCGGCGAGCGGG + Exonic
1103521067 12:121537356-121537378 TAGCGGCCGTGGCACCGAGCCGG - Intronic
1104678466 12:130731845-130731867 CAGGGGCCACGGAGCAGAGCAGG + Intergenic
1106304095 13:28495045-28495067 CAGCGGCGGCGGCTCGGAGCGGG - Exonic
1106598767 13:31169643-31169665 CAGAGGCAGCTGAGCAGAGCAGG - Intergenic
1106665462 13:31846773-31846795 CAGCGAGCGCAGCGCAGCGCAGG + Intergenic
1107604034 13:42040820-42040842 CAGCGGCGGCGGCGGGGACCCGG + Intronic
1107836137 13:44413797-44413819 CAGCTGCCTTGGCGCAGGGCAGG + Intergenic
1108710435 13:53027814-53027836 CAGCATCCCCGGCCCAGAGCTGG + Intergenic
1110451029 13:75637067-75637089 CAGAGCGCGCGGTGCAGAGCTGG + Intronic
1112041518 13:95552698-95552720 CGGGGGTCGCGGCGCAGAGTGGG + Intronic
1113656165 13:112068737-112068759 CAGCGGCCGCGGCGCAGAGCCGG + Exonic
1114046492 14:18880720-18880742 AAGCGCCCGCGGAGCAGAGCAGG - Intergenic
1114117720 14:19638730-19638752 AAGCGCCCGCGGAGCAGAGCAGG + Intergenic
1117135391 14:52730282-52730304 CAGCGGCGGCGGCGAAGACAGGG - Exonic
1117803215 14:59465312-59465334 TAGCGGCCGCCGCGGGGAGCTGG + Exonic
1118366641 14:65102234-65102256 CAGCGGCCGGGGCTCTTAGCGGG - Intronic
1118992605 14:70809617-70809639 CAGCGGGCGCGGGGCGGGGCGGG - Intergenic
1119539286 14:75428168-75428190 GGGCGGCAGCGGCGCGGAGCGGG + Intronic
1119617892 14:76110878-76110900 CAGCTGTCGAGGAGCAGAGCTGG - Intergenic
1121313391 14:92947053-92947075 GAGCAGCTGGGGCGCAGAGCCGG + Intronic
1122226856 14:100285443-100285465 CAGCGGACGCGGCCCAGCCCCGG - Intergenic
1122418212 14:101560484-101560506 CAGCGGGCGCGGGGCGGCGCCGG - Intergenic
1122425325 14:101602227-101602249 CAGGGGACGCAGCACAGAGCGGG + Intergenic
1125175604 15:36818336-36818358 CAGCGGCGGCTGCCCAGAACAGG - Intergenic
1126348078 15:47717497-47717519 CAGCAGCAGCGGGACAGAGCAGG - Intronic
1126569651 15:50136762-50136784 CAGCTGCTGCGTGGCAGAGCTGG - Intronic
1128736661 15:70057506-70057528 CAGCGGCGGCGGCGCTCATCTGG + Exonic
1128841468 15:70854229-70854251 CGGCGGCGGCGGCGCGGGGCGGG - Intronic
1129052848 15:72796996-72797018 GAGCGGCCGCGGCGCGGGGTGGG + Intergenic
1130908404 15:88255464-88255486 CAGCGGCGGCAGCGCTTAGCCGG - Intronic
1130969207 15:88718885-88718907 CAGAGGCCACAGCACAGAGCAGG - Intergenic
1131056596 15:89378769-89378791 AAGCGCCCGCAGCCCAGAGCTGG + Intergenic
1131473343 15:92714883-92714905 CAGCCGCCCCGCCGCAGAACCGG + Intronic
1132542795 16:519149-519171 CAGCGGCCTGGGCCCTGAGCTGG - Intronic
1132641700 16:981110-981132 AAGGGGCCGCGGCTCGGAGCTGG - Intronic
1132677078 16:1125262-1125284 CATGGGCCGCTGTGCAGAGCAGG - Intergenic
1132741310 16:1414650-1414672 CGGCGGCAGCGGCGCTGAGCGGG - Exonic
1132842274 16:1984012-1984034 CAGAGGCCGCGGCGCTGGCCGGG - Intronic
1133298404 16:4766927-4766949 CCGAGGCCGCGGCACAGACCCGG + Intronic
1133814265 16:9184343-9184365 CAGCTGCCTCCCCGCAGAGCAGG - Intergenic
1134172081 16:11976762-11976784 CAGCGGCGGCGGCGCGGCGCAGG + Exonic
1135404041 16:22185404-22185426 CATCGGCCGTGGCTCAGGGCCGG - Intronic
1136406794 16:30052991-30053013 GGGCCGCGGCGGCGCAGAGCCGG + Intergenic
1137614520 16:49838790-49838812 AAGCGGCCGCGGCGGGGGGCCGG - Intronic
1139506246 16:67399498-67399520 GACCGGCCGGGCCGCAGAGCGGG - Intronic
1139890643 16:70251485-70251507 TAGCGGCCCAGGCGCACAGCCGG + Exonic
1140223113 16:73058195-73058217 CGGCGGCGGCGGCGCGGGGCCGG + Intronic
1141175122 16:81713648-81713670 CAGCTGCTGCGGGGCAGAGCAGG - Intergenic
1142140895 16:88472249-88472271 CTGGGACCGAGGCGCAGAGCTGG - Intronic
1142240050 16:88940931-88940953 GCGCGGCTGCGGCGCAGATCCGG + Intronic
1142240184 16:88941392-88941414 CAGCGGCGGCGGCGGGGGGCAGG - Intronic
1142240884 16:88944477-88944499 TAGGGCCCGCGGCGCACAGCGGG + Intronic
1142315451 16:89341863-89341885 CAGCGGCCACGGCCCACGGCAGG + Intronic
1142315463 16:89341905-89341927 CAGCGGCCACGGCCCACGGCGGG + Intronic
1142315495 16:89342037-89342059 CAGCGGCCACGGCCCACGGCGGG + Intronic
1142378849 16:89720852-89720874 CAGCGGCCATGGCGCCGAGCGGG + Exonic
1142465366 17:134107-134129 CCGGGGGCGCGGCGCAGAGACGG + Intergenic
1144608620 17:16689629-16689651 CAGCGGCTGCGGCACACGGCGGG + Intergenic
1144656948 17:17042803-17042825 CGGCGGCGGCGGCGCAGGCCTGG - Exonic
1144753097 17:17663570-17663592 CAGCAGACGCTCCGCAGAGCAGG + Intergenic
1145041369 17:19580151-19580173 GAGCGGCCGCCGCGCAGGGGTGG + Intergenic
1145128395 17:20320544-20320566 CAGCGGCTGCGGCACAGGGCGGG + Intergenic
1145196217 17:20896670-20896692 CAGCGGCTGCGGCACAGGGCGGG - Intergenic
1146935109 17:36808356-36808378 CAGCGGCCGGGGAGCCGGGCGGG + Intergenic
1147400416 17:40177554-40177576 CTGCCGCCGCAGCGCAGAGCCGG + Intronic
1147754800 17:42761220-42761242 GAGCGGCGGCGGCGCTGAGCCGG - Exonic
1148566026 17:48633563-48633585 CAGCGGCCGCGGCCCAGTCCAGG + Intronic
1148945818 17:51260740-51260762 CAGCGGCCGCCGCGCTCGGCCGG - Exonic
1149430355 17:56592687-56592709 GAGCGGCGGCCGCGCGGAGCCGG + Intergenic
1150108424 17:62478629-62478651 CAGCGGCCGCGCTGCCGGGCAGG - Intronic
1150292406 17:63989187-63989209 CAGAGGCTGCGGGACAGAGCAGG + Intergenic
1151559018 17:74861017-74861039 AAGCCGCCGGGGCGGAGAGCGGG - Intronic
1151856583 17:76726338-76726360 CGGCGGCCGTGGCGGTGAGCGGG - Exonic
1152155365 17:78629400-78629422 CAGCGGCCTGAGCGGAGAGCGGG + Intergenic
1152225405 17:79090467-79090489 CAGCGGCGGCGGAGCAGGCCCGG - Intronic
1152245591 17:79183162-79183184 TGGCGGCGGCGGCGCAGAGGCGG + Intronic
1152588658 17:81200369-81200391 CAGGTGCAGCGGCGCGGAGCAGG - Exonic
1152751808 17:82065744-82065766 CGGCGGCCCCGGCGCGGTGCGGG - Intronic
1152928790 17:83099772-83099794 CAGCAGCCTCGGAGCAGAGTGGG + Intergenic
1154132892 18:11751651-11751673 AGGCGGCCGCGGCGCAGCGGAGG + Intronic
1155007436 18:21741322-21741344 CGGAGGCGGCGGCGGAGAGCGGG - Exonic
1155519603 18:26656111-26656133 CAGCGCTCGGGGCGCAGAGGTGG - Intronic
1156495862 18:37524832-37524854 CAGCGACCGCAGCGCCCAGCAGG + Intronic
1156788123 18:40939835-40939857 CTGCGGCAGCCGCGCAGGGCTGG - Intergenic
1157492791 18:48136138-48136160 CAGCGGCCGCGGGGCTGGCCTGG - Intronic
1158505662 18:58044359-58044381 GCGCGGCGGCGGCGCAGACCCGG - Exonic
1160706309 19:531790-531812 CGGCGGCGGCGGCGCAGAGGAGG + Exonic
1160968590 19:1757531-1757553 CAGCGGACCCGGCAGAGAGCAGG - Intronic
1161033889 19:2073259-2073281 CAGGGGCCGAGCCGCTGAGCAGG - Exonic
1161189372 19:2944671-2944693 CAGCGGCCGAGGGGTAGGGCTGG - Intronic
1161304146 19:3557586-3557608 CAGCCGCCGGGCCCCAGAGCCGG + Intronic
1161371317 19:3913541-3913563 CAAGGGCCTCGGCGCAGACCCGG + Intronic
1161397884 19:4054398-4054420 CTACGGCCGCGGCGGAGAGGAGG - Exonic
1161703243 19:5805935-5805957 CGGCGGCGGCGGCGGCGAGCAGG - Intergenic
1161793173 19:6372980-6373002 TAGCGGCGGCGGCGCAGCTCGGG - Exonic
1162302402 19:9851201-9851223 CTGTGGCCGCTGGGCAGAGCTGG + Intergenic
1162951349 19:14073575-14073597 CAGCGGCTGCGGCGGCGACCGGG - Exonic
1163167599 19:15508617-15508639 GCGCGGCCGCGGCGCTGCGCTGG + Intronic
1163502828 19:17686762-17686784 AAGCTGCCGCGGCGGGGAGCGGG + Intronic
1163668204 19:18612878-18612900 CAGCGGCTGCGGCGGGGACCGGG - Exonic
1165486427 19:36099458-36099480 CCACGGCCGCTGGGCAGAGCGGG + Exonic
1165735066 19:38170582-38170604 CAGAGGCCCCGGTGCACAGCAGG - Intronic
1165892973 19:39125898-39125920 GAGCGACTGCGGCGCCGAGCCGG + Exonic
1165899688 19:39163311-39163333 CAGGGGCCCAGGGGCAGAGCAGG - Intronic
1166100834 19:40570553-40570575 CGGCGGCCGCGGCCCAGAGAGGG + Exonic
1167369651 19:49072825-49072847 CGGCGGCGGCGGGGCAGGGCAGG - Exonic
926097515 2:10091640-10091662 TAGCGGCCGCGCCGCGGGGCAGG + Intergenic
926269649 2:11355623-11355645 CAGCCCCTGGGGCGCAGAGCAGG - Intergenic
928094180 2:28393801-28393823 CAGCGGCGGCGGCGGCCAGCAGG + Exonic
929218115 2:39437105-39437127 CGGCGGCCGCAGCGTGGAGCCGG - Exonic
931694234 2:64859897-64859919 CAGCGGGGGCGGCGCCGAGAGGG + Intergenic
933752477 2:85611848-85611870 TGGCGGCGGCGGCGCAGGGCGGG + Intronic
934079068 2:88452325-88452347 CTGCGGCGGCGGCGGAGGGCGGG + Exonic
934566712 2:95345684-95345706 CAGCGGGCGCGGCGCACTGTGGG - Intronic
936122657 2:109760349-109760371 CGGCGGCGGCGGCGCAGGGCCGG + Intergenic
936122690 2:109760418-109760440 CGGCGGCGGCGGCGCAGGGCCGG + Intergenic
936222003 2:110611055-110611077 CGGCGGCGGCGGCGCAGGGCCGG - Intergenic
936222036 2:110611124-110611146 CGGCGGCGGCGGCGCAGGGCCGG - Intergenic
936278726 2:111120775-111120797 CGGCGGCCGCGGCGCCGAGGGGG + Intronic
938266869 2:129934185-129934207 AAGCGCCCACGGCACAGAGCAGG + Intergenic
942454804 2:176130336-176130358 CAGCGGCGGCGGCCCCGGGCGGG - Exonic
942642293 2:178072672-178072694 CAGCGGCGGCAGCTCAGTGCTGG - Exonic
943185167 2:184598315-184598337 CTGCGGCAGCGGCGCCGCGCGGG + Intergenic
944172976 2:196799736-196799758 CTGCAGCTGCGGCGCAGACCGGG - Intergenic
944412444 2:199457729-199457751 CGGCGGCGGCGGCGGCGAGCCGG + Exonic
946966441 2:225042287-225042309 CGGCGGACGCGGCGCTGTGCCGG + Exonic
947117906 2:226791542-226791564 CGGCGGGCGCGGTGCAGAGGGGG + Intronic
947667919 2:231918759-231918781 CAGCGCCCGTGGGGCAGAGGTGG - Intergenic
1168753036 20:297393-297415 CAGCGCAGGGGGCGCAGAGCCGG + Exonic
1168830224 20:841601-841623 CAGAGGCCGCGGGGCAGGGCTGG - Intronic
1168887005 20:1266793-1266815 CACCTGCCGCGGTGCAGCGCAGG - Intronic
1171186787 20:23128630-23128652 CAGCGGCCTCAGCACAGAGCAGG - Intergenic
1172474399 20:35226542-35226564 CAGGGGCCGCGGAGCGGCGCTGG - Intergenic
1172654363 20:36527997-36528019 CAGCGGCGGCGGCGCTGGGTGGG - Exonic
1174172439 20:48625850-48625872 CAGAGGCCGCGGCCCAGCGTGGG + Exonic
1174386501 20:50190943-50190965 CAGCGGCGACAGCTCAGAGCAGG + Exonic
1176089362 20:63312160-63312182 CAGCGGCCACGAGGCACAGCGGG + Intronic
1176194599 20:63831372-63831394 CCGCGGCCGGGGCGCGGCGCGGG - Intergenic
1176218599 20:63959578-63959600 CAGGGGCTGCAGCGCAGAGTAGG - Exonic
1178561541 21:33643015-33643037 CCGCGGCCCCGCCGCCGAGCGGG + Intronic
1179116029 21:38493662-38493684 CAGCAGCCTCGGCTCAGAACAGG + Intronic
1179500137 21:41803508-41803530 CAGAGGCCGCGGGGCAGTGGTGG + Intronic
1179913809 21:44463774-44463796 CAGCGGCCTCGGCGGAGCGCTGG - Intergenic
1179954783 21:44732523-44732545 CCGCGGCCGGGGCCCAGACCGGG + Intergenic
1180231994 21:46432166-46432188 CAGCGGCTGCGGAGCAGTGGAGG + Exonic
1180465028 22:15603356-15603378 AAGCGCCCGCGGAGCAGAGCAGG - Intergenic
1180843721 22:18970688-18970710 CAGGCGGCGGGGCGCAGAGCGGG + Intergenic
1182374722 22:29838194-29838216 CGGCGGCGGCGGCACAGAGCCGG - Exonic
1182771790 22:32801690-32801712 CCCAGGCAGCGGCGCAGAGCGGG + Exonic
1183546294 22:38456053-38456075 CGGGGCCCGCGGCGCGGAGCAGG + Intergenic
1184321076 22:43742665-43742687 CAGCGGGGGCTGCGCAGAGTGGG - Intronic
1184410827 22:44325380-44325402 CAGAGACCGAGGCTCAGAGCTGG + Intergenic
1184412164 22:44331697-44331719 CGCCGGGCGCGGCGCGGAGCTGG + Intergenic
950168029 3:10816215-10816237 CCGGGGCGGCGGCGCAGAGCCGG + Exonic
953627242 3:44581038-44581060 CGGCGGCGGCGGCGCAGGCCCGG + Intronic
955291027 3:57692728-57692750 CAGCCGCCCCGGCGCAGGGGAGG + Intronic
958462246 3:94413204-94413226 CAGCAGCAGAGGGGCAGAGCTGG + Intergenic
961015739 3:123466805-123466827 CAGCCACAGCGGAGCAGAGCAGG + Intergenic
966907953 3:184541408-184541430 CAGTGGCCACGGTGCAGAGATGG - Intronic
967930429 3:194686776-194686798 CGGCGGCGGCGGCGGAGCGCCGG - Exonic
968561463 4:1285345-1285367 GAGCGGCTGCCGCGCAGAGAAGG + Intergenic
968599488 4:1502348-1502370 CGGCTCCCGCGGCCCAGAGCTGG + Intergenic
968965151 4:3765940-3765962 CGGCGGCGGCGGCGCAGCTCCGG + Intergenic
969292018 4:6246023-6246045 CAGGGCGCGCGGCACAGAGCAGG - Intergenic
969425058 4:7119402-7119424 CAGAGGACGCGGGGTAGAGCTGG + Intergenic
970394774 4:15655108-15655130 CTGCGGGCGCGGCGCAGGCCAGG + Intronic
970441188 4:16082711-16082733 CAGGGGCCGCGGCGGGGAACTGG - Intronic
973292342 4:48483304-48483326 GCGGGGCCGCGGCGCGGAGCCGG + Intergenic
977536536 4:98261310-98261332 CGGCGGGCGCGGCTCCGAGCGGG - Intergenic
979349325 4:119627493-119627515 CGACGGCCGCTGCCCAGAGCAGG + Intronic
984862499 4:184253161-184253183 CAGCCGCCTCCCCGCAGAGCAGG + Intergenic
985607369 5:865234-865256 TCGCGGCCTCGGTGCAGAGCCGG - Intronic
985629044 5:1005363-1005385 CAGCGGCTGCAGCGCAGCTCGGG - Intergenic
985652096 5:1112028-1112050 CGGCGGGAGCGGCGCAGCGCGGG - Exonic
985896305 5:2751596-2751618 CGGCGGCAGCAGCGCGGAGCCGG + Exonic
987441874 5:17966910-17966932 CAGCTGCAGCCTCGCAGAGCCGG - Intergenic
988941486 5:36152068-36152090 GTGCGGCCGCGAAGCAGAGCGGG + Exonic
989812569 5:45695862-45695884 CGGCGGCGGCGGCGAGGAGCCGG - Exonic
990041979 5:51387450-51387472 GAGCGGAGGCGGCCCAGAGCGGG - Intronic
992249981 5:74866594-74866616 CGGCGGCCGGGGCGGAGAGAGGG - Intronic
992473112 5:77077231-77077253 GAGCGGCGGCGGCGCAGCGGGGG + Exonic
994359954 5:98839541-98839563 CAGCGGCCCCCGCGCTGTGCAGG + Intergenic
997230514 5:132239079-132239101 CAGCAGTCAGGGCGCAGAGCAGG - Intronic
997266005 5:132495950-132495972 CAGCGGCCGCGACCTGGAGCGGG + Intergenic
997463447 5:134071259-134071281 CAGCGGGGGCGGCGCCGTGCGGG + Intergenic
997718786 5:136061923-136061945 CAGAGGCCCCGGCTCAGGGCAGG - Intronic
999300202 5:150486154-150486176 GAGCTGCCCCGGCGCAGCGCCGG + Intronic
999300241 5:150486240-150486262 CGGCGGCGGCGGCGTGGAGCGGG + Intronic
1001822505 5:174721098-174721120 CAGCGGGGGCGGGGCAGGGCGGG + Intergenic
1002185869 5:177454623-177454645 CGGCGGCCGGGGCTCAGATCGGG + Intronic
1002926395 6:1608149-1608171 CAGAGACCCCGGCGCACAGCAGG + Intergenic
1003544903 6:7051442-7051464 GGGCGGCTGCGGCGCGGAGCCGG + Intergenic
1004495735 6:16160937-16160959 CAAAGGCCATGGCGCAGAGCAGG - Intergenic
1006547493 6:34792049-34792071 GGGCGGCCGCGGCGCCGCGCTGG + Intronic
1007431513 6:41779903-41779925 CCGCGGCCGCGGGGCGGGGCGGG - Intronic
1010141923 6:72622254-72622276 CAGCGGCGGCGGCGGCGGGCGGG + Exonic
1012912747 6:105136665-105136687 CAGCGGCCGCCGCTCAGGTCAGG - Intronic
1015366356 6:132401491-132401513 GAGCGGCAGCGGCGGCGAGCGGG + Exonic
1016658072 6:146543742-146543764 CAGCGGGCGCGGCGGAGGGCTGG + Exonic
1017021398 6:150143061-150143083 GGGCGCGCGCGGCGCAGAGCAGG + Exonic
1017021595 6:150143807-150143829 CAGCTGCAGCTGCGCAAAGCGGG + Intronic
1018091336 6:160348666-160348688 CAGCGGCCGCGGCGCTCGGGGGG - Exonic
1018400379 6:163414795-163414817 AGGCGGCGGCGGCGCTGAGCGGG + Exonic
1019198462 6:170295982-170296004 AAGGAGCCGCGGCGCAGAGGAGG - Intronic
1019417943 7:935751-935773 CGGCACCCGCGGGGCAGAGCAGG - Intronic
1019636803 7:2080444-2080466 CAGTGGCCGAGGCGGGGAGCCGG - Intronic
1020204540 7:6104891-6104913 CGGCGGGCGCGGCGCTGACCCGG + Exonic
1020278205 7:6637239-6637261 CGGGGGCAGCGGCGCGGAGCGGG - Intergenic
1021868186 7:24979583-24979605 CAGGGGCCGCGGCGCAGGTGCGG - Intronic
1023054986 7:36283990-36284012 CGGCGGCAGCAGCGCAAAGCAGG + Intronic
1023638807 7:42237969-42237991 CGGCGGCGGCGGCGGAGGGCGGG - Intergenic
1026909433 7:74083815-74083837 AAGCCGCCGCGGCGCCGAGCCGG + Intronic
1027390276 7:77696898-77696920 CAGCGGCGGCGGCGGCGGGCAGG - Exonic
1028641137 7:93043491-93043513 CAGCTGCCGCAGCCCAGCGCCGG + Intergenic
1030262484 7:107580257-107580279 CGGCGGCCGCGGAGCAGCGCAGG + Intronic
1032037463 7:128531163-128531185 CAGCGGCCGCGCTGCCGGGCAGG - Intergenic
1034129074 7:148699070-148699092 CGGCGGCGGCGGCGCAGGCCCGG + Intronic
1035023051 7:155809941-155809963 CAGGGGCCGGGGCGCATCGCGGG - Intronic
1037787819 8:21912854-21912876 CAGTGGCCGAGGCCCAGAGGAGG + Intronic
1040531560 8:48270511-48270533 CAGCAGCGGCTGCCCAGAGCTGG - Intergenic
1043502808 8:80873845-80873867 CCGCCGCCGCCGCGCAGCGCCGG - Intronic
1045098947 8:98825893-98825915 CTGCGGCGGCGGCCCAGAGAAGG + Intronic
1047732400 8:127737784-127737806 GAGGGGCCCCGGCGCGGAGCGGG + Intronic
1049109664 8:140635298-140635320 CGGCGGCGGCGGGGCCGAGCCGG - Intronic
1049161833 8:141102942-141102964 CAGCGGCCTGGGAGCAAAGCCGG + Intergenic
1049396472 8:142403271-142403293 CAGAGGCCCCGGCGCGGAGCCGG + Intergenic
1049620904 8:143597931-143597953 CGGCGGCCGCGGCGCGGTACCGG - Exonic
1049784608 8:144444442-144444464 GCGGGGCCGCGGCGCAGCGCGGG - Exonic
1053643123 9:40106765-40106787 CGGCGGCTGCGGCGCAGCCCGGG + Intergenic
1053763027 9:41358724-41358746 CGGCGGCTGCGGCGCAGCCCCGG - Intergenic
1054541633 9:66269838-66269860 CGGCGGCTGCGGCGCAGCCCCGG - Intergenic
1056732608 9:89178645-89178667 CAGCGGCGGCCGCGCAGCCCCGG + Exonic
1058058610 9:100473428-100473450 TAGCAGCCGCGCCGCTGAGCCGG - Exonic
1060389812 9:123268272-123268294 TGGCGGCCGAGGCGGAGAGCAGG - Intronic
1060810846 9:126610839-126610861 CAGGGGCCGAGGCCCAGAGCCGG - Intergenic
1061859326 9:133460101-133460123 CTGCGCGGGCGGCGCAGAGCTGG - Exonic
1061889319 9:133609292-133609314 TCGCGGCCGCAGCGCGGAGCTGG - Intergenic
1062070186 9:134551232-134551254 CCGCAGCTGCGGGGCAGAGCTGG + Intergenic
1062596407 9:137301884-137301906 CTGCGTCTGCGGCGCGGAGCAGG + Exonic
1062718832 9:138024221-138024243 CAGTGGGCTGGGCGCAGAGCGGG + Intronic
1203771687 EBV:52930-52952 CGGCGGCGGCGGCGCTGAGGCGG + Intergenic
1188483064 X:30653708-30653730 CAGCGGCCGGGGCACCGGGCCGG - Intronic
1189324596 X:40105103-40105125 CAGCGGCGGCGGCGGCGAGGAGG + Intronic
1190640812 X:52481757-52481779 CAGGGGCTGGGGCTCAGAGCCGG + Intergenic
1190646860 X:52531108-52531130 CAGGGGCTGGGGCTCAGAGCCGG - Intergenic
1191250556 X:58258153-58258175 CAGCAGCCCCTGCGCAGGGCTGG + Intergenic
1195702541 X:107716148-107716170 CGGCGGCAGCAGCGCTGAGCCGG - Intronic
1197749951 X:129957403-129957425 CTGTCGCCGCGGCGCAGGGCCGG - Intergenic
1199772596 X:150984039-150984061 CGGCGGCGGCGGCGCCGGGCGGG - Intronic
1200084770 X:153598804-153598826 CACCGGGCGCGGCGCAAAGGCGG + Intronic
1200746848 Y:6910817-6910839 CCGCGGCGGCGGGGCAGAGGCGG + Exonic