ID: 1113657245

View in Genome Browser
Species Human (GRCh38)
Location 13:112074687-112074709
Sequence CGTTGTTTGTGGAGAGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113657243_1113657245 -3 Left 1113657243 13:112074667-112074689 CCATGTGGGTGCATTGAAGACGT 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1113657245 13:112074687-112074709 CGTTGTTTGTGGAGAGCAGCAGG 0: 1
1: 0
2: 0
3: 16
4: 172
1113657241_1113657245 11 Left 1113657241 13:112074653-112074675 CCACTTCAGAGCAACCATGTGGG 0: 1
1: 0
2: 0
3: 14
4: 132
Right 1113657245 13:112074687-112074709 CGTTGTTTGTGGAGAGCAGCAGG 0: 1
1: 0
2: 0
3: 16
4: 172
1113657239_1113657245 17 Left 1113657239 13:112074647-112074669 CCTCGGCCACTTCAGAGCAACCA 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1113657245 13:112074687-112074709 CGTTGTTTGTGGAGAGCAGCAGG 0: 1
1: 0
2: 0
3: 16
4: 172
1113657238_1113657245 18 Left 1113657238 13:112074646-112074668 CCCTCGGCCACTTCAGAGCAACC 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1113657245 13:112074687-112074709 CGTTGTTTGTGGAGAGCAGCAGG 0: 1
1: 0
2: 0
3: 16
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113657245 Original CRISPR CGTTGTTTGTGGAGAGCAGC AGG Intergenic
900936391 1:5768864-5768886 CATTGTTTCTGGAGAGGACCAGG - Intergenic
901029831 1:6300633-6300655 CTGTGTTTGTGGAGAGAGGCCGG - Intronic
901146922 1:7071117-7071139 CCTTGTTTGAGGAGAGGAGGAGG - Intronic
901526745 1:9827879-9827901 GGGTGTTTGTGGAGCGGAGCCGG + Intergenic
902363735 1:15957361-15957383 CGGTGTGTGTGGAGAGGAGGAGG + Intronic
902363745 1:15957400-15957422 CGGTGTGTGTGGAGAGGAGGAGG + Intronic
902363754 1:15957439-15957461 CGGTGTATCTGGAGAGGAGCAGG + Intronic
903039048 1:20514735-20514757 CCTTCTGTGTGGTGAGCAGCAGG - Intergenic
905853620 1:41292565-41292587 CATTGTTTCTGGAGGCCAGCAGG - Intergenic
910617501 1:89215703-89215725 CTTTCTGTGTGGTGAGCAGCAGG + Intergenic
911067946 1:93808668-93808690 TTTTGTTTTTGGAGGGCAGCTGG + Intronic
913241606 1:116834958-116834980 ATTTGTTTGGGCAGAGCAGCAGG - Intergenic
914794641 1:150909726-150909748 CTTTCTGTGTGGTGAGCAGCAGG - Intergenic
920029433 1:203027517-203027539 CGTTCTGTGTGGAGAGCAAGTGG + Intronic
920360824 1:205414996-205415018 CTTTGTATGTGAAGAGCTGCAGG + Intronic
921650119 1:217667948-217667970 AATTGTCTGTGGAGAGCAGCAGG - Intronic
923365048 1:233251497-233251519 CCTTGTCTGTTGTGAGCAGCTGG + Intronic
924320475 1:242843605-242843627 CTTTCTGTGTGGTGAGCAGCAGG - Intergenic
924853387 1:247853326-247853348 CTTTCTGTGTGGAGAGCAGCAGG + Intergenic
1064192619 10:13220843-13220865 GGAGGTTTGTGGAGAGCTGCGGG + Intergenic
1065081539 10:22134529-22134551 CATGGTTTGTGGATTGCAGCTGG - Intergenic
1071871987 10:89806211-89806233 TATTCTTTGTGGAGAGCAGCAGG + Intergenic
1072040957 10:91606198-91606220 CTTTCTGTGTGGTGAGCAGCAGG + Intergenic
1076054847 10:127364080-127364102 GGGTGTTTGTGGAGTGCAGGGGG + Intronic
1080139353 11:28897214-28897236 TGTTGTATGTGTAGAGCTGCTGG + Intergenic
1081585202 11:44379538-44379560 CATTGTGTGTGGACATCAGCTGG - Intergenic
1085076227 11:73595151-73595173 CGTTGTTTTTGCAGATCTGCAGG - Intronic
1086009522 11:82083307-82083329 CTTTGTTGGTGTAGGGCAGCTGG + Intergenic
1087684025 11:101243388-101243410 TGTTTTGTGTGGAGAGCAGTGGG - Intergenic
1089432771 11:118436904-118436926 CCGTGTTTGGGGAGAGCGGCGGG + Exonic
1090274428 11:125409642-125409664 GGAGGTGTGTGGAGAGCAGCCGG + Intronic
1090416229 11:126542361-126542383 CTTTGTTAGTGGAGAAGAGCAGG + Intronic
1092585633 12:9898548-9898570 CATTCTGTGTGGTGAGCAGCAGG + Intergenic
1098435472 12:70464087-70464109 CTTTCTGTGTGGTGAGCAGCAGG - Intergenic
1102444878 12:112994340-112994362 CTTTCTATGTGGTGAGCAGCAGG + Intronic
1103982808 12:124747471-124747493 GCTTATTTGTGGACAGCAGCGGG + Intergenic
1104611057 12:130228162-130228184 CTTTCTGTGTGGTGAGCAGCAGG - Intergenic
1104746880 12:131216160-131216182 GGGTGTCTGGGGAGAGCAGCTGG - Intergenic
1104785737 12:131447023-131447045 GGGTGTCTGGGGAGAGCAGCTGG + Intergenic
1105895327 13:24712339-24712361 CGTTATTGCTGGAGAGCACCTGG - Intronic
1106590925 13:31097998-31098020 CTTTCTGTGTGGTGAGCAGCAGG - Intergenic
1108181828 13:47847858-47847880 CATTATTTTTGGGGAGCAGCTGG + Intergenic
1108192565 13:47957316-47957338 CTTTCTGTGTGGCGAGCAGCAGG + Intronic
1108855611 13:54789306-54789328 CTTTCTGTGTGGTGAGCAGCAGG - Intergenic
1109428817 13:62205097-62205119 CTTTCTTTGTGGTGAGCAACGGG - Intergenic
1111201909 13:84949071-84949093 CTTTCTTTGCAGAGAGCAGCAGG + Intergenic
1111290491 13:86162378-86162400 CTTTCTGTGTGGGGAGCAGCAGG - Intergenic
1111352425 13:87048657-87048679 CTTTCTGTGTGGAGAGCAGCAGG - Intergenic
1112723307 13:102272050-102272072 GTTGGTGTGTGGAGAGCAGCTGG - Intronic
1113657245 13:112074687-112074709 CGTTGTTTGTGGAGAGCAGCAGG + Intergenic
1115887738 14:37992705-37992727 TGCTGTTTGTGAACAGCAGCAGG + Intronic
1116171139 14:41404462-41404484 CCTTGTCTGAGGAGAGGAGCAGG - Intergenic
1122718674 14:103709988-103710010 CGCTGTCTGTGGCGAGAAGCCGG - Intronic
1124062268 15:26305475-26305497 CTTTCTGTGTGGTGAGCAGCAGG + Intergenic
1128253855 15:66182874-66182896 CGTTTATGGTGGAGAGAAGCTGG + Intronic
1129702070 15:77773910-77773932 TGTTGTTTGTGGGGACCAGCAGG - Intronic
1130105955 15:80928649-80928671 CGTTGAATGTGGAGAGCCACAGG + Intronic
1132556554 16:575241-575263 CTGTGATTGTGGAGAGAAGCAGG - Intronic
1132889620 16:2197175-2197197 CATTATTTGCGGAGAGGAGCAGG - Intergenic
1134078922 16:11311536-11311558 CTTTCTGTGTGGCGAGCAGCAGG + Intronic
1135075573 16:19390511-19390533 CTTTCTGTGTGGTGAGCAGCAGG + Intergenic
1135094721 16:19555623-19555645 CCATGTTTGTGAAGGGCAGCTGG - Exonic
1136515626 16:30766507-30766529 AGTTCTTTGTGGCCAGCAGCAGG - Exonic
1138494566 16:57399896-57399918 CTTTCTGTGTGGGGAGCAGCAGG - Intergenic
1139525851 16:67515931-67515953 CTTTCTGTGTGGCGAGCAGCAGG + Intergenic
1139800529 16:69519050-69519072 CGTTGTTCCTTGAGTGCAGCAGG + Intergenic
1143681724 17:8480793-8480815 TGTTGTCTGTGGAGAACAGCTGG - Intronic
1148767843 17:50049582-50049604 CGTTGTATGCTGAGGGCAGCAGG + Intergenic
1155790841 18:29968774-29968796 CTTTTTTTGTGGCAAGCAGCAGG - Intergenic
1155821428 18:30382834-30382856 CTTTCTGTGTGGAAAGCAGCAGG - Intergenic
1156035116 18:32757459-32757481 CGTTCCTTGTGGGGATCAGCAGG - Intronic
1157709935 18:49843261-49843283 CGTTGATGGTGGAGGTCAGCAGG + Exonic
1161768153 19:6217933-6217955 AGGTGTGTATGGAGAGCAGCTGG - Exonic
1162197382 19:8995965-8995987 CTTTCTGTGTGGTGAGCAGCAGG + Intergenic
1166303472 19:41924828-41924850 CGGTGTTTCTGGAGAGAAGCAGG + Intronic
1167503810 19:49861218-49861240 CGTTTATTGTGGAGGGGAGCTGG + Exonic
1168121025 19:54252593-54252615 AGTTGTGTGTGCAGGGCAGCTGG - Intronic
925955544 2:8960554-8960576 CTATGGTTGTGGAGATCAGCGGG - Intronic
928238603 2:29567161-29567183 CTTTGGTTGTTGAGAACAGCTGG - Intronic
929446327 2:42004115-42004137 CTTTGTGTGTGGTGAGCAGCAGG - Intergenic
931321963 2:61180588-61180610 CGCTGCTGGAGGAGAGCAGCTGG - Intronic
934234905 2:90222110-90222132 CTTTCTGTGTGGTGAGCAGCAGG - Intergenic
935938267 2:108209869-108209891 CTTTCTTTGTGGTGAGCTGCAGG + Intergenic
935962213 2:108436946-108436968 CTTTCTGTGTGGAGAGCAGCAGG - Intergenic
936789433 2:116133740-116133762 CGTGGTGTGCGGTGAGCAGCCGG - Intergenic
937369111 2:121285391-121285413 CGGAGTTTGGGGAGAGCACCCGG - Intergenic
937892439 2:126948786-126948808 TGTTGTTTGAGGAGGGCAGTGGG + Intergenic
943551003 2:189339523-189339545 CTTTCTGTGTGGTGAGCAGCAGG - Intergenic
948818317 2:240525276-240525298 CTTTCTGTGTGGTGAGCAGCAGG + Intronic
949061397 2:241960020-241960042 TGGTGTTTGTGGAGAAAAGCTGG - Intergenic
949071916 2:242030437-242030459 CTTTCTGTGTGGTGAGCAGCGGG - Intergenic
1170071368 20:12372724-12372746 TGTTCTCTGTGGAGAACAGCTGG - Intergenic
1170496078 20:16926851-16926873 CTTTCTTTGTGGTGAGCAACCGG + Intergenic
1170524977 20:17227992-17228014 CGTTGTTCCCGGAGAGGAGCAGG - Intronic
1170928749 20:20749239-20749261 CTTTCTGTGTGGTGAGCAGCAGG + Intergenic
1171358806 20:24572189-24572211 CTTTCTGTGTGGCGAGCAGCAGG + Intronic
1172962776 20:38810223-38810245 GGATGTTTTTGGAGAGCAGTGGG + Intronic
1174788447 20:53455142-53455164 CGTTATGTGTGGCGAGCAGTAGG + Intronic
1175777109 20:61660262-61660284 TGTTGTAAGTGGAGGGCAGCAGG - Intronic
1177802199 21:25839103-25839125 CTTTCTGTGTGGTGAGCAGCAGG - Intergenic
1182877007 22:33700930-33700952 CGTGGTCTGAGGTGAGCAGCTGG + Intronic
1183981006 22:41540204-41540226 CGCTGCCTGTGGAGAGCAGACGG - Intronic
1184731652 22:46373994-46374016 CGTTGTTTCTGGAGGGTGGCTGG - Intronic
1185095410 22:48803625-48803647 GGCTGTTTGAGGAGGGCAGCTGG + Intronic
949134827 3:551723-551745 CTTTCTGTGCGGAGAGCAGCAGG + Intergenic
949463468 3:4319279-4319301 CATTCTGTGTGGTGAGCAGCAGG - Intronic
949581478 3:5392749-5392771 GGTTGTTTCTGGAGTGCAGTGGG + Intergenic
950268953 3:11597804-11597826 CTTTCTGTGTGGTGAGCAGCAGG + Intronic
951393312 3:22133805-22133827 CTTTGTTTGTGGAGAAAAGTAGG - Intronic
953570341 3:44066473-44066495 CCTTCTTTCTGGACAGCAGCAGG + Intergenic
954230790 3:49215571-49215593 CTTTCTGTGTGGCGAGCAGCAGG - Intronic
954647090 3:52138177-52138199 CGTGGAGTGTGTAGAGCAGCCGG + Exonic
954892752 3:53946311-53946333 CTTTCTGTGTGGTGAGCAGCAGG + Intergenic
955220174 3:57016818-57016840 TCTTCTTTGTGGAGTGCAGCTGG + Intronic
955928247 3:64029167-64029189 GGATGTTGGAGGAGAGCAGCCGG + Intergenic
957037029 3:75302907-75302929 CCTTATATGTGGAGAGAAGCAGG - Intergenic
961393744 3:126571644-126571666 CTTTGGTTTTGGTGAGCAGCGGG - Intergenic
962352036 3:134663523-134663545 CGGGGTTTGTGGGCAGCAGCAGG - Intronic
963001749 3:140688083-140688105 CGTAGTTTATTGAGTGCAGCCGG - Exonic
966868509 3:184275894-184275916 CGGTGTTGCTGGAGGGCAGCTGG + Intronic
967823423 3:193859362-193859384 CATTGTTTGTGGGGAGCATAAGG + Intergenic
968483599 4:848354-848376 GGTTATGTGTGGAGAGCAGCGGG - Intergenic
971584280 4:28385371-28385393 CATTGTTTAAGGAGACCAGCTGG - Intronic
972791503 4:42375528-42375550 CTTTTTGTGTGGTGAGCAGCAGG + Intergenic
973138516 4:46736206-46736228 CTTTCTGTGTGGTGAGCAGCAGG - Intronic
977179520 4:93857018-93857040 AGTTCATTTTGGAGAGCAGCTGG + Intergenic
982868056 4:160543143-160543165 CATTGTATGTGGATCGCAGCAGG + Intergenic
984269499 4:177533813-177533835 CTTTCTGTGTGGCGAGCAGCAGG + Intergenic
985271920 4:188201675-188201697 CTTTCTGTGTGGCGAGCAGCAGG - Intergenic
985477796 5:89674-89696 CATTGTTGGTGCTGAGCAGCAGG - Intergenic
985508029 5:295768-295790 CTTTCTGTGTGGAGAGCAGCGGG - Intronic
985740006 5:1609901-1609923 CTTTCTGTGTGGAGAGCAGCGGG + Intergenic
985750769 5:1673081-1673103 CGTGGCTTGAGGCGAGCAGCAGG + Intergenic
986643069 5:9890927-9890949 CGTTTTTTGGGGACAGCATCTGG + Intergenic
987540048 5:19243317-19243339 TGATGTTTGTGGACAGCAGATGG + Intergenic
987672665 5:21032583-21032605 CTTTCTTTGTGGCCAGCAGCAGG - Intergenic
987817112 5:22916972-22916994 GGTCTTTTGTGGAAAGCAGCAGG + Intergenic
988390715 5:30625701-30625723 CTTTCTGTGAGGAGAGCAGCAGG - Intergenic
990782302 5:59378870-59378892 GGATGTGTGTGGAGAGGAGCTGG - Intronic
994357484 5:98810300-98810322 CTTTGTTTATGGAGAACAGGAGG - Intergenic
996915809 5:128711099-128711121 CTTTCTTTGTGGTGAGCAGCGGG + Intronic
997044717 5:130300413-130300435 AGTGGTTTATGGAGAGCAGCGGG + Intergenic
997472079 5:134122751-134122773 CCTTGTTTGTACACAGCAGCAGG - Intronic
998109890 5:139493083-139493105 TGATGTGTGTGCAGAGCAGCAGG + Intergenic
999373154 5:151068499-151068521 CGTGGTTTGTGGACAGCAGAGGG - Intronic
1000567961 5:162874736-162874758 CTTTCTGTGTGGTGAGCAGCAGG - Intergenic
1003294390 6:4811454-4811476 TCTTGTTTGAGGAGAGGAGCTGG + Intronic
1008178882 6:48303131-48303153 CTTTCTTTGTGGCAAGCAGCAGG + Intergenic
1011692957 6:89886933-89886955 CGTTGCTGGGGGACAGCAGCTGG - Intergenic
1013198527 6:107867488-107867510 GGTTGTCTGTGGAGTGCAGGTGG - Intergenic
1014139898 6:117929309-117929331 CTTTTTGTGTGGTGAGCAGCAGG + Intronic
1014474409 6:121854549-121854571 CGTGGTGGGTGGAGAGCAGTGGG + Intergenic
1015721747 6:136249937-136249959 CGCTGTGTTTGGAGAGCACCAGG - Intronic
1016201081 6:141409226-141409248 CTTTCTGTGTGGTGAGCAGCAGG + Intergenic
1016682865 6:146850898-146850920 AGTTGTTTGTAGAAAGAAGCAGG + Intergenic
1018039321 6:159907750-159907772 TGTTGATTGTGGAGAAGAGCAGG - Exonic
1018998065 6:168725168-168725190 GGGTGGTTGTGGAAAGCAGCAGG - Intergenic
1019079990 6:169423988-169424010 CATTGTTGCTGCAGAGCAGCTGG + Intergenic
1019262744 7:91314-91336 CATTTTGTGTGGAGAACAGCAGG + Intergenic
1020675390 7:11178087-11178109 TGTTCTTCGTGGAGAGCAGTAGG + Intergenic
1020783089 7:12539643-12539665 CTTTCTGTGTGGTGAGCAGCAGG - Intergenic
1021588707 7:22237740-22237762 CTTTCTGTGTGGTGAGCAGCAGG + Intronic
1025850480 7:65239706-65239728 CGCGGTGTGTGGTGAGCAGCAGG - Intergenic
1026217990 7:68366471-68366493 AGTAGTTTTTGGAGAGCAGGTGG + Intergenic
1028740904 7:94273961-94273983 CTTTCTGTGTGGAGAGCAGGAGG - Intergenic
1030021007 7:105275195-105275217 CTTTCCTTGTGGAGAGCAGCAGG + Intronic
1031987776 7:128174491-128174513 CGGTGTGTGCTGAGAGCAGCGGG + Intergenic
1034772303 7:153791971-153791993 CACTGTTTGTGGAGAGCACATGG - Intergenic
1035378413 7:158422939-158422961 CTTTATCTCTGGAGAGCAGCAGG - Intronic
1036522664 8:9506584-9506606 CTTTGTATGTAGTGAGCAGCAGG + Intergenic
1038412084 8:27366804-27366826 GGCTGTGTGTGGAGAGCAGAGGG + Intronic
1039186249 8:34919923-34919945 AAGTGTTTGTGGAAAGCAGCTGG - Intergenic
1040046286 8:42967258-42967280 AGGTGTGTGTGGAGGGCAGCCGG - Intronic
1040659435 8:49553007-49553029 CTTTCTGTGCGGAGAGCAGCAGG + Intronic
1040957255 8:52992116-52992138 CTTTCTGTGTGGTGAGCAGCAGG + Intergenic
1042483828 8:69330733-69330755 CTTTTTGTGTGGTGAGCAGCGGG - Intergenic
1042811742 8:72833140-72833162 CGTTGGTTTTGGAAAGCAGAAGG + Intronic
1043095114 8:75959032-75959054 CTTTGTTTGTGGACAGGAACAGG + Intergenic
1048010674 8:130452964-130452986 CTTTCTATGTGGCGAGCAGCAGG + Intergenic
1056133231 9:83605832-83605854 CGGGGTTTCTGGAAAGCAGCTGG - Intergenic
1058555726 9:106164465-106164487 CATTGTTTTTGGAGAGGAGAGGG + Intergenic
1059341478 9:113599884-113599906 CTTTGGCTGTGCAGAGCAGCTGG + Intergenic
1061286731 9:129627757-129627779 GGATCTTTGTGGACAGCAGCAGG - Intronic
1061563735 9:131423457-131423479 TGATGTTTGTGAAAAGCAGCTGG + Intronic
1185473704 X:400480-400502 CGCTATTTTTGGAGGGCAGCTGG + Intergenic
1186840289 X:13478401-13478423 GGTTATCTGTGGAGACCAGCTGG - Intergenic
1188244626 X:27824871-27824893 AGTTATTTGTGTAGGGCAGCTGG - Intergenic
1191673510 X:63770812-63770834 CATTGTATGTGGATGGCAGCAGG - Intronic
1196601093 X:117602805-117602827 TGTAGTTTGGGCAGAGCAGCTGG + Intergenic