ID: 1113659137

View in Genome Browser
Species Human (GRCh38)
Location 13:112092795-112092817
Sequence GGTCCCAGAGGAGCCCGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113659137_1113659151 20 Left 1113659137 13:112092795-112092817 CCTGCCCGGGCTCCTCTGGGACC No data
Right 1113659151 13:112092838-112092860 CAGGACACTGGGCAATCCTGGGG No data
1113659137_1113659147 8 Left 1113659137 13:112092795-112092817 CCTGCCCGGGCTCCTCTGGGACC No data
Right 1113659147 13:112092826-112092848 GAAGGCTCATGGCAGGACACTGG No data
1113659137_1113659149 18 Left 1113659137 13:112092795-112092817 CCTGCCCGGGCTCCTCTGGGACC No data
Right 1113659149 13:112092836-112092858 GGCAGGACACTGGGCAATCCTGG No data
1113659137_1113659146 1 Left 1113659137 13:112092795-112092817 CCTGCCCGGGCTCCTCTGGGACC No data
Right 1113659146 13:112092819-112092841 GCTTTGGGAAGGCTCATGGCAGG No data
1113659137_1113659144 -3 Left 1113659137 13:112092795-112092817 CCTGCCCGGGCTCCTCTGGGACC No data
Right 1113659144 13:112092815-112092837 ACCTGCTTTGGGAAGGCTCATGG No data
1113659137_1113659143 -10 Left 1113659137 13:112092795-112092817 CCTGCCCGGGCTCCTCTGGGACC No data
Right 1113659143 13:112092808-112092830 CTCTGGGACCTGCTTTGGGAAGG No data
1113659137_1113659150 19 Left 1113659137 13:112092795-112092817 CCTGCCCGGGCTCCTCTGGGACC No data
Right 1113659150 13:112092837-112092859 GCAGGACACTGGGCAATCCTGGG No data
1113659137_1113659148 9 Left 1113659137 13:112092795-112092817 CCTGCCCGGGCTCCTCTGGGACC No data
Right 1113659148 13:112092827-112092849 AAGGCTCATGGCAGGACACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113659137 Original CRISPR GGTCCCAGAGGAGCCCGGGC AGG (reversed) Intergenic
No off target data available for this crispr