ID: 1113662312

View in Genome Browser
Species Human (GRCh38)
Location 13:112116078-112116100
Sequence GTCGCGTCCCAGACATTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113662306_1113662312 6 Left 1113662306 13:112116049-112116071 CCCGAGTTCAGGCTCAGCCATGC No data
Right 1113662312 13:112116078-112116100 GTCGCGTCCCAGACATTTGGAGG No data
1113662305_1113662312 7 Left 1113662305 13:112116048-112116070 CCCCGAGTTCAGGCTCAGCCATG No data
Right 1113662312 13:112116078-112116100 GTCGCGTCCCAGACATTTGGAGG No data
1113662307_1113662312 5 Left 1113662307 13:112116050-112116072 CCGAGTTCAGGCTCAGCCATGCT No data
Right 1113662312 13:112116078-112116100 GTCGCGTCCCAGACATTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113662312 Original CRISPR GTCGCGTCCCAGACATTTGG AGG Intergenic
No off target data available for this crispr