ID: 1113664059

View in Genome Browser
Species Human (GRCh38)
Location 13:112128566-112128588
Sequence TGAGGCTCCTGGAGAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113664059_1113664064 4 Left 1113664059 13:112128566-112128588 CCTGTTTTTCTCCAGGAGCCTCA No data
Right 1113664064 13:112128593-112128615 TAAATCCTCTTACTGCCCATGGG No data
1113664059_1113664063 3 Left 1113664059 13:112128566-112128588 CCTGTTTTTCTCCAGGAGCCTCA No data
Right 1113664063 13:112128592-112128614 GTAAATCCTCTTACTGCCCATGG No data
1113664059_1113664067 11 Left 1113664059 13:112128566-112128588 CCTGTTTTTCTCCAGGAGCCTCA No data
Right 1113664067 13:112128600-112128622 TCTTACTGCCCATGGGGATGTGG No data
1113664059_1113664065 5 Left 1113664059 13:112128566-112128588 CCTGTTTTTCTCCAGGAGCCTCA No data
Right 1113664065 13:112128594-112128616 AAATCCTCTTACTGCCCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113664059 Original CRISPR TGAGGCTCCTGGAGAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr