ID: 1113665052

View in Genome Browser
Species Human (GRCh38)
Location 13:112135780-112135802
Sequence CCGTCCCCGGCAGGGGCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113665052_1113665058 0 Left 1113665052 13:112135780-112135802 CCTAGGGCCCCTGCCGGGGACGG No data
Right 1113665058 13:112135803-112135825 TCCCAGACACCCACAGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113665052 Original CRISPR CCGTCCCCGGCAGGGGCCCT AGG (reversed) Intergenic
No off target data available for this crispr