ID: 1113665323

View in Genome Browser
Species Human (GRCh38)
Location 13:112137004-112137026
Sequence TCAGAGACCTAAAGCCTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113665323_1113665324 -10 Left 1113665323 13:112137004-112137026 CCTCAGAGGCTTTAGGTCTCTGA No data
Right 1113665324 13:112137017-112137039 AGGTCTCTGACATAGAAACAAGG No data
1113665323_1113665325 23 Left 1113665323 13:112137004-112137026 CCTCAGAGGCTTTAGGTCTCTGA No data
Right 1113665325 13:112137050-112137072 CAGCTCCAGCATGCTGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113665323 Original CRISPR TCAGAGACCTAAAGCCTCTG AGG (reversed) Intergenic
No off target data available for this crispr