ID: 1113665324

View in Genome Browser
Species Human (GRCh38)
Location 13:112137017-112137039
Sequence AGGTCTCTGACATAGAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113665323_1113665324 -10 Left 1113665323 13:112137004-112137026 CCTCAGAGGCTTTAGGTCTCTGA No data
Right 1113665324 13:112137017-112137039 AGGTCTCTGACATAGAAACAAGG No data
1113665322_1113665324 -6 Left 1113665322 13:112137000-112137022 CCATCCTCAGAGGCTTTAGGTCT No data
Right 1113665324 13:112137017-112137039 AGGTCTCTGACATAGAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113665324 Original CRISPR AGGTCTCTGACATAGAAACA AGG Intergenic
No off target data available for this crispr