ID: 1113665325

View in Genome Browser
Species Human (GRCh38)
Location 13:112137050-112137072
Sequence CAGCTCCAGCATGCTGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113665323_1113665325 23 Left 1113665323 13:112137004-112137026 CCTCAGAGGCTTTAGGTCTCTGA No data
Right 1113665325 13:112137050-112137072 CAGCTCCAGCATGCTGAGCTAGG No data
1113665322_1113665325 27 Left 1113665322 13:112137000-112137022 CCATCCTCAGAGGCTTTAGGTCT No data
Right 1113665325 13:112137050-112137072 CAGCTCCAGCATGCTGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113665325 Original CRISPR CAGCTCCAGCATGCTGAGCT AGG Intergenic
No off target data available for this crispr