ID: 1113667556

View in Genome Browser
Species Human (GRCh38)
Location 13:112151346-112151368
Sequence CAGGATGATCTATCTGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113667553_1113667556 -7 Left 1113667553 13:112151330-112151352 CCCAGTATTTCATGCTCAGGATG No data
Right 1113667556 13:112151346-112151368 CAGGATGATCTATCTGGTCAAGG No data
1113667550_1113667556 21 Left 1113667550 13:112151302-112151324 CCAGGCCTGGAGCAGGTGAAATA No data
Right 1113667556 13:112151346-112151368 CAGGATGATCTATCTGGTCAAGG No data
1113667551_1113667556 16 Left 1113667551 13:112151307-112151329 CCTGGAGCAGGTGAAATAATTTG No data
Right 1113667556 13:112151346-112151368 CAGGATGATCTATCTGGTCAAGG No data
1113667554_1113667556 -8 Left 1113667554 13:112151331-112151353 CCAGTATTTCATGCTCAGGATGA No data
Right 1113667556 13:112151346-112151368 CAGGATGATCTATCTGGTCAAGG No data
1113667549_1113667556 25 Left 1113667549 13:112151298-112151320 CCAGCCAGGCCTGGAGCAGGTGA No data
Right 1113667556 13:112151346-112151368 CAGGATGATCTATCTGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113667556 Original CRISPR CAGGATGATCTATCTGGTCA AGG Intergenic
No off target data available for this crispr