ID: 1113670902

View in Genome Browser
Species Human (GRCh38)
Location 13:112175475-112175497
Sequence CAGAATCTGGAGGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113670896_1113670902 -4 Left 1113670896 13:112175456-112175478 CCGACTGGAGTGATGCGGCCAGA No data
Right 1113670902 13:112175475-112175497 CAGAATCTGGAGGAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113670902 Original CRISPR CAGAATCTGGAGGAGGAGGA AGG Intergenic
No off target data available for this crispr