ID: 1113672434

View in Genome Browser
Species Human (GRCh38)
Location 13:112184150-112184172
Sequence AAGAAGAAGGAGAAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113672430_1113672434 8 Left 1113672430 13:112184119-112184141 CCACACTTTAAAAAAAGGAAGAA No data
Right 1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113672434 Original CRISPR AAGAAGAAGGAGAAGGAGAA GGG Intergenic
No off target data available for this crispr