ID: 1113673205

View in Genome Browser
Species Human (GRCh38)
Location 13:112189010-112189032
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113673198_1113673205 22 Left 1113673198 13:112188965-112188987 CCTTTCATACAATTTAAACTTGG No data
Right 1113673205 13:112189010-112189032 CTGTAGACTAGGAGAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113673205 Original CRISPR CTGTAGACTAGGAGAGAGGA AGG Intergenic
No off target data available for this crispr