ID: 1113673809

View in Genome Browser
Species Human (GRCh38)
Location 13:112194792-112194814
Sequence GAGCGCGGAAACGCTGGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113673809_1113673816 2 Left 1113673809 13:112194792-112194814 CCCATGCCAGCGTTTCCGCGCTC No data
Right 1113673816 13:112194817-112194839 CCCGTTGTCCCTGCAGGCCCTGG No data
1113673809_1113673813 -4 Left 1113673809 13:112194792-112194814 CCCATGCCAGCGTTTCCGCGCTC No data
Right 1113673813 13:112194811-112194833 GCTCACCCCGTTGTCCCTGCAGG No data
1113673809_1113673819 7 Left 1113673809 13:112194792-112194814 CCCATGCCAGCGTTTCCGCGCTC No data
Right 1113673819 13:112194822-112194844 TGTCCCTGCAGGCCCTGGCTGGG No data
1113673809_1113673822 17 Left 1113673809 13:112194792-112194814 CCCATGCCAGCGTTTCCGCGCTC No data
Right 1113673822 13:112194832-112194854 GGCCCTGGCTGGGCATGAACTGG No data
1113673809_1113673823 18 Left 1113673809 13:112194792-112194814 CCCATGCCAGCGTTTCCGCGCTC No data
Right 1113673823 13:112194833-112194855 GCCCTGGCTGGGCATGAACTGGG No data
1113673809_1113673818 6 Left 1113673809 13:112194792-112194814 CCCATGCCAGCGTTTCCGCGCTC No data
Right 1113673818 13:112194821-112194843 TTGTCCCTGCAGGCCCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113673809 Original CRISPR GAGCGCGGAAACGCTGGCAT GGG (reversed) Intergenic
No off target data available for this crispr