ID: 1113673818

View in Genome Browser
Species Human (GRCh38)
Location 13:112194821-112194843
Sequence TTGTCCCTGCAGGCCCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113673806_1113673818 17 Left 1113673806 13:112194781-112194803 CCAAACCCACACCCATGCCAGCG No data
Right 1113673818 13:112194821-112194843 TTGTCCCTGCAGGCCCTGGCTGG No data
1113673811_1113673818 0 Left 1113673811 13:112194798-112194820 CCAGCGTTTCCGCGCTCACCCCG No data
Right 1113673818 13:112194821-112194843 TTGTCCCTGCAGGCCCTGGCTGG No data
1113673803_1113673818 22 Left 1113673803 13:112194776-112194798 CCTCCCCAAACCCACACCCATGC No data
Right 1113673818 13:112194821-112194843 TTGTCCCTGCAGGCCCTGGCTGG No data
1113673800_1113673818 29 Left 1113673800 13:112194769-112194791 CCTCCCGCCTCCCCAAACCCACA No data
Right 1113673818 13:112194821-112194843 TTGTCCCTGCAGGCCCTGGCTGG No data
1113673801_1113673818 26 Left 1113673801 13:112194772-112194794 CCCGCCTCCCCAAACCCACACCC No data
Right 1113673818 13:112194821-112194843 TTGTCCCTGCAGGCCCTGGCTGG No data
1113673808_1113673818 11 Left 1113673808 13:112194787-112194809 CCACACCCATGCCAGCGTTTCCG No data
Right 1113673818 13:112194821-112194843 TTGTCCCTGCAGGCCCTGGCTGG No data
1113673810_1113673818 5 Left 1113673810 13:112194793-112194815 CCATGCCAGCGTTTCCGCGCTCA No data
Right 1113673818 13:112194821-112194843 TTGTCCCTGCAGGCCCTGGCTGG No data
1113673804_1113673818 19 Left 1113673804 13:112194779-112194801 CCCCAAACCCACACCCATGCCAG No data
Right 1113673818 13:112194821-112194843 TTGTCCCTGCAGGCCCTGGCTGG No data
1113673809_1113673818 6 Left 1113673809 13:112194792-112194814 CCCATGCCAGCGTTTCCGCGCTC No data
Right 1113673818 13:112194821-112194843 TTGTCCCTGCAGGCCCTGGCTGG No data
1113673805_1113673818 18 Left 1113673805 13:112194780-112194802 CCCAAACCCACACCCATGCCAGC No data
Right 1113673818 13:112194821-112194843 TTGTCCCTGCAGGCCCTGGCTGG No data
1113673802_1113673818 25 Left 1113673802 13:112194773-112194795 CCGCCTCCCCAAACCCACACCCA No data
Right 1113673818 13:112194821-112194843 TTGTCCCTGCAGGCCCTGGCTGG No data
1113673807_1113673818 12 Left 1113673807 13:112194786-112194808 CCCACACCCATGCCAGCGTTTCC No data
Right 1113673818 13:112194821-112194843 TTGTCCCTGCAGGCCCTGGCTGG No data
1113673812_1113673818 -9 Left 1113673812 13:112194807-112194829 CCGCGCTCACCCCGTTGTCCCTG No data
Right 1113673818 13:112194821-112194843 TTGTCCCTGCAGGCCCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113673818 Original CRISPR TTGTCCCTGCAGGCCCTGGC TGG Intergenic
No off target data available for this crispr