ID: 1113673823

View in Genome Browser
Species Human (GRCh38)
Location 13:112194833-112194855
Sequence GCCCTGGCTGGGCATGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113673806_1113673823 29 Left 1113673806 13:112194781-112194803 CCAAACCCACACCCATGCCAGCG No data
Right 1113673823 13:112194833-112194855 GCCCTGGCTGGGCATGAACTGGG No data
1113673814_1113673823 -6 Left 1113673814 13:112194816-112194838 CCCCGTTGTCCCTGCAGGCCCTG No data
Right 1113673823 13:112194833-112194855 GCCCTGGCTGGGCATGAACTGGG No data
1113673809_1113673823 18 Left 1113673809 13:112194792-112194814 CCCATGCCAGCGTTTCCGCGCTC No data
Right 1113673823 13:112194833-112194855 GCCCTGGCTGGGCATGAACTGGG No data
1113673807_1113673823 24 Left 1113673807 13:112194786-112194808 CCCACACCCATGCCAGCGTTTCC No data
Right 1113673823 13:112194833-112194855 GCCCTGGCTGGGCATGAACTGGG No data
1113673810_1113673823 17 Left 1113673810 13:112194793-112194815 CCATGCCAGCGTTTCCGCGCTCA No data
Right 1113673823 13:112194833-112194855 GCCCTGGCTGGGCATGAACTGGG No data
1113673817_1113673823 -8 Left 1113673817 13:112194818-112194840 CCGTTGTCCCTGCAGGCCCTGGC No data
Right 1113673823 13:112194833-112194855 GCCCTGGCTGGGCATGAACTGGG No data
1113673805_1113673823 30 Left 1113673805 13:112194780-112194802 CCCAAACCCACACCCATGCCAGC No data
Right 1113673823 13:112194833-112194855 GCCCTGGCTGGGCATGAACTGGG No data
1113673812_1113673823 3 Left 1113673812 13:112194807-112194829 CCGCGCTCACCCCGTTGTCCCTG No data
Right 1113673823 13:112194833-112194855 GCCCTGGCTGGGCATGAACTGGG No data
1113673815_1113673823 -7 Left 1113673815 13:112194817-112194839 CCCGTTGTCCCTGCAGGCCCTGG No data
Right 1113673823 13:112194833-112194855 GCCCTGGCTGGGCATGAACTGGG No data
1113673811_1113673823 12 Left 1113673811 13:112194798-112194820 CCAGCGTTTCCGCGCTCACCCCG No data
Right 1113673823 13:112194833-112194855 GCCCTGGCTGGGCATGAACTGGG No data
1113673808_1113673823 23 Left 1113673808 13:112194787-112194809 CCACACCCATGCCAGCGTTTCCG No data
Right 1113673823 13:112194833-112194855 GCCCTGGCTGGGCATGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113673823 Original CRISPR GCCCTGGCTGGGCATGAACT GGG Intergenic
No off target data available for this crispr