ID: 1113678293

View in Genome Browser
Species Human (GRCh38)
Location 13:112223239-112223261
Sequence TGGCACGGGGAAGTGGCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113678293_1113678311 30 Left 1113678293 13:112223239-112223261 CCCCATGCCACTTCCCCGTGCCA No data
Right 1113678311 13:112223292-112223314 GGGGCCCAGCCATGGTGACATGG No data
1113678293_1113678302 -8 Left 1113678293 13:112223239-112223261 CCCCATGCCACTTCCCCGTGCCA No data
Right 1113678302 13:112223254-112223276 CCGTGCCAGGTGAGGACCACAGG No data
1113678293_1113678307 9 Left 1113678293 13:112223239-112223261 CCCCATGCCACTTCCCCGTGCCA No data
Right 1113678307 13:112223271-112223293 CACAGGGCTGCTGGCACATCTGG No data
1113678293_1113678303 -7 Left 1113678293 13:112223239-112223261 CCCCATGCCACTTCCCCGTGCCA No data
Right 1113678303 13:112223255-112223277 CGTGCCAGGTGAGGACCACAGGG No data
1113678293_1113678308 10 Left 1113678293 13:112223239-112223261 CCCCATGCCACTTCCCCGTGCCA No data
Right 1113678308 13:112223272-112223294 ACAGGGCTGCTGGCACATCTGGG No data
1113678293_1113678310 22 Left 1113678293 13:112223239-112223261 CCCCATGCCACTTCCCCGTGCCA No data
Right 1113678310 13:112223284-112223306 GCACATCTGGGGCCCAGCCATGG No data
1113678293_1113678305 0 Left 1113678293 13:112223239-112223261 CCCCATGCCACTTCCCCGTGCCA No data
Right 1113678305 13:112223262-112223284 GGTGAGGACCACAGGGCTGCTGG No data
1113678293_1113678309 11 Left 1113678293 13:112223239-112223261 CCCCATGCCACTTCCCCGTGCCA No data
Right 1113678309 13:112223273-112223295 CAGGGCTGCTGGCACATCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113678293 Original CRISPR TGGCACGGGGAAGTGGCATG GGG (reversed) Intergenic
No off target data available for this crispr