ID: 1113679640

View in Genome Browser
Species Human (GRCh38)
Location 13:112234413-112234435
Sequence CAGCCCAGCCCCATATCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113679636_1113679640 -10 Left 1113679636 13:112234400-112234422 CCCTTCCTCTGTGCAGCCCAGCC No data
Right 1113679640 13:112234413-112234435 CAGCCCAGCCCCATATCCCAGGG No data
1113679634_1113679640 -6 Left 1113679634 13:112234396-112234418 CCCTCCCTTCCTCTGTGCAGCCC No data
Right 1113679640 13:112234413-112234435 CAGCCCAGCCCCATATCCCAGGG No data
1113679633_1113679640 -5 Left 1113679633 13:112234395-112234417 CCCCTCCCTTCCTCTGTGCAGCC No data
Right 1113679640 13:112234413-112234435 CAGCCCAGCCCCATATCCCAGGG No data
1113679632_1113679640 11 Left 1113679632 13:112234379-112234401 CCAGCAAGCACTGGGTCCCCTCC No data
Right 1113679640 13:112234413-112234435 CAGCCCAGCCCCATATCCCAGGG No data
1113679629_1113679640 23 Left 1113679629 13:112234367-112234389 CCACACTTCTGGCCAGCAAGCAC No data
Right 1113679640 13:112234413-112234435 CAGCCCAGCCCCATATCCCAGGG No data
1113679635_1113679640 -7 Left 1113679635 13:112234397-112234419 CCTCCCTTCCTCTGTGCAGCCCA No data
Right 1113679640 13:112234413-112234435 CAGCCCAGCCCCATATCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113679640 Original CRISPR CAGCCCAGCCCCATATCCCA GGG Intergenic
No off target data available for this crispr