ID: 1113682184

View in Genome Browser
Species Human (GRCh38)
Location 13:112252279-112252301
Sequence CTGTTAACTCAAGTGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113682178_1113682184 16 Left 1113682178 13:112252240-112252262 CCGGGCATTAAGGAGCCCAGGAT No data
Right 1113682184 13:112252279-112252301 CTGTTAACTCAAGTGGAGCCTGG No data
1113682182_1113682184 0 Left 1113682182 13:112252256-112252278 CCAGGATTTCGGGTCTGACTTTG No data
Right 1113682184 13:112252279-112252301 CTGTTAACTCAAGTGGAGCCTGG No data
1113682181_1113682184 1 Left 1113682181 13:112252255-112252277 CCCAGGATTTCGGGTCTGACTTT No data
Right 1113682184 13:112252279-112252301 CTGTTAACTCAAGTGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113682184 Original CRISPR CTGTTAACTCAAGTGGAGCC TGG Intergenic
No off target data available for this crispr