ID: 1113682292

View in Genome Browser
Species Human (GRCh38)
Location 13:112252994-112253016
Sequence CGTGCCGGGCAGTCACAACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113682292_1113682301 23 Left 1113682292 13:112252994-112253016 CCGGGTTGTGACTGCCCGGCACG No data
Right 1113682301 13:112253040-112253062 ACAGCGAGATCGGTGCCTGATGG No data
1113682292_1113682300 13 Left 1113682292 13:112252994-112253016 CCGGGTTGTGACTGCCCGGCACG No data
Right 1113682300 13:112253030-112253052 GACATTGAGAACAGCGAGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113682292 Original CRISPR CGTGCCGGGCAGTCACAACC CGG (reversed) Intergenic
No off target data available for this crispr