ID: 1113682649

View in Genome Browser
Species Human (GRCh38)
Location 13:112255095-112255117
Sequence CTGTGGGACTGGTGGGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113682638_1113682649 13 Left 1113682638 13:112255059-112255081 CCTAGGCCAACTCTGAGTGAGTG No data
Right 1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG No data
1113682637_1113682649 14 Left 1113682637 13:112255058-112255080 CCCTAGGCCAACTCTGAGTGAGT No data
Right 1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG No data
1113682639_1113682649 7 Left 1113682639 13:112255065-112255087 CCAACTCTGAGTGAGTGTCAAAG No data
Right 1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113682649 Original CRISPR CTGTGGGACTGGTGGGGAGA TGG Intergenic
No off target data available for this crispr