ID: 1113684952

View in Genome Browser
Species Human (GRCh38)
Location 13:112276659-112276681
Sequence AGGATTGATCCATGCTTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113684952_1113684959 19 Left 1113684952 13:112276659-112276681 CCAGGTAAGCATGGATCAATCCT No data
Right 1113684959 13:112276701-112276723 GCGTGGAACATTCCTTCAGATGG No data
1113684952_1113684960 26 Left 1113684952 13:112276659-112276681 CCAGGTAAGCATGGATCAATCCT No data
Right 1113684960 13:112276708-112276730 ACATTCCTTCAGATGGAGCAAGG No data
1113684952_1113684957 2 Left 1113684952 13:112276659-112276681 CCAGGTAAGCATGGATCAATCCT No data
Right 1113684957 13:112276684-112276706 AGGATGCGGCCAGGTAAGCGTGG No data
1113684952_1113684955 -7 Left 1113684952 13:112276659-112276681 CCAGGTAAGCATGGATCAATCCT No data
Right 1113684955 13:112276675-112276697 CAATCCTTCAGGATGCGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113684952 Original CRISPR AGGATTGATCCATGCTTACC TGG (reversed) Intergenic
No off target data available for this crispr