ID: 1113684956

View in Genome Browser
Species Human (GRCh38)
Location 13:112276679-112276701
Sequence CTTACCTGGCCGCATCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113684956_1113684959 -1 Left 1113684956 13:112276679-112276701 CCTTCAGGATGCGGCCAGGTAAG No data
Right 1113684959 13:112276701-112276723 GCGTGGAACATTCCTTCAGATGG No data
1113684956_1113684960 6 Left 1113684956 13:112276679-112276701 CCTTCAGGATGCGGCCAGGTAAG No data
Right 1113684960 13:112276708-112276730 ACATTCCTTCAGATGGAGCAAGG No data
1113684956_1113684962 15 Left 1113684956 13:112276679-112276701 CCTTCAGGATGCGGCCAGGTAAG No data
Right 1113684962 13:112276717-112276739 CAGATGGAGCAAGGTAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113684956 Original CRISPR CTTACCTGGCCGCATCCTGA AGG (reversed) Intergenic
No off target data available for this crispr