ID: 1113684958

View in Genome Browser
Species Human (GRCh38)
Location 13:112276693-112276715
Sequence AGGAATGTTCCACGCTTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113684958_1113684962 1 Left 1113684958 13:112276693-112276715 CCAGGTAAGCGTGGAACATTCCT No data
Right 1113684962 13:112276717-112276739 CAGATGGAGCAAGGTAAGCATGG No data
1113684958_1113684964 26 Left 1113684958 13:112276693-112276715 CCAGGTAAGCGTGGAACATTCCT No data
Right 1113684964 13:112276742-112276764 CATTTTTTCAAGATAAAGCCAGG No data
1113684958_1113684960 -8 Left 1113684958 13:112276693-112276715 CCAGGTAAGCGTGGAACATTCCT No data
Right 1113684960 13:112276708-112276730 ACATTCCTTCAGATGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113684958 Original CRISPR AGGAATGTTCCACGCTTACC TGG (reversed) Intergenic
No off target data available for this crispr