ID: 1113684960

View in Genome Browser
Species Human (GRCh38)
Location 13:112276708-112276730
Sequence ACATTCCTTCAGATGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113684956_1113684960 6 Left 1113684956 13:112276679-112276701 CCTTCAGGATGCGGCCAGGTAAG No data
Right 1113684960 13:112276708-112276730 ACATTCCTTCAGATGGAGCAAGG No data
1113684958_1113684960 -8 Left 1113684958 13:112276693-112276715 CCAGGTAAGCGTGGAACATTCCT No data
Right 1113684960 13:112276708-112276730 ACATTCCTTCAGATGGAGCAAGG No data
1113684952_1113684960 26 Left 1113684952 13:112276659-112276681 CCAGGTAAGCATGGATCAATCCT No data
Right 1113684960 13:112276708-112276730 ACATTCCTTCAGATGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113684960 Original CRISPR ACATTCCTTCAGATGGAGCA AGG Intergenic
No off target data available for this crispr