ID: 1113685016

View in Genome Browser
Species Human (GRCh38)
Location 13:112277075-112277097
Sequence GCATCCTGAGGAAATGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113685016_1113685023 27 Left 1113685016 13:112277075-112277097 CCTGGACCATTTCCTCAGGATGC No data
Right 1113685023 13:112277125-112277147 AGGATGCAGATATAAAAGTGTGG No data
1113685016_1113685020 7 Left 1113685016 13:112277075-112277097 CCTGGACCATTTCCTCAGGATGC No data
Right 1113685020 13:112277105-112277127 TAAGCATGAACCATTCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113685016 Original CRISPR GCATCCTGAGGAAATGGTCC AGG (reversed) Intergenic