ID: 1113692371

View in Genome Browser
Species Human (GRCh38)
Location 13:112320325-112320347
Sequence GTGGGTGAGTTGAGGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113692371_1113692379 2 Left 1113692371 13:112320325-112320347 CCCTCCAGCCTCAACTCACCCAC No data
Right 1113692379 13:112320350-112320372 GCCTGCTTTCATTCAATCGAAGG No data
1113692371_1113692381 8 Left 1113692371 13:112320325-112320347 CCCTCCAGCCTCAACTCACCCAC No data
Right 1113692381 13:112320356-112320378 TTTCATTCAATCGAAGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113692371 Original CRISPR GTGGGTGAGTTGAGGCTGGA GGG (reversed) Intergenic
No off target data available for this crispr