ID: 1113692651

View in Genome Browser
Species Human (GRCh38)
Location 13:112322638-112322660
Sequence AAGGCATTCAACGCGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 48}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113692647_1113692651 8 Left 1113692647 13:112322607-112322629 CCCAGTTCAAGCTGGCATAGGAA 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1113692651 13:112322638-112322660 AAGGCATTCAACGCGGCTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 48
1113692648_1113692651 7 Left 1113692648 13:112322608-112322630 CCAGTTCAAGCTGGCATAGGAAA 0: 1
1: 0
2: 0
3: 14
4: 150
Right 1113692651 13:112322638-112322660 AAGGCATTCAACGCGGCTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113692651 Original CRISPR AAGGCATTCAACGCGGCTGC AGG Intergenic
901595425 1:10381853-10381875 AAGGCATACAAGGAGGCTTCAGG - Intergenic
907487726 1:54788825-54788847 AATGCATTCACCCCAGCTGCTGG - Intronic
921745513 1:218735964-218735986 AAGGCATTCAACAGGTCAGCTGG + Intergenic
1067084397 10:43230186-43230208 AAGGCATTCAAGTCGAATGCTGG - Intronic
1070633412 10:78104910-78104932 AAGCCATTCAACGAGTCTGTAGG - Intergenic
1087082704 11:94187163-94187185 AAGGCATTCATGGCGGCAGATGG - Intergenic
1092054820 12:5500087-5500109 AAAGCATTCAAAGCTGGTGCTGG + Intronic
1093051595 12:14510840-14510862 AAAGCACTCAAAGCAGCTGCAGG - Intronic
1103137359 12:118519136-118519158 AAGTCATTCAGGGAGGCTGCAGG - Intergenic
1103870600 12:124088523-124088545 ACGGCATTCACCTCGGCTCCAGG - Exonic
1103967739 12:124650987-124651009 AAGGCAAGCAGCGGGGCTGCAGG - Intergenic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1104939748 12:132389464-132389486 GAGGCAATTAACGTGGCTGCTGG - Intergenic
1108463547 13:50692170-50692192 AAGGCAGCCAACACGGCTGGAGG - Intronic
1109667677 13:65559877-65559899 AAGGCATTCAACAAGTCTCCAGG + Intergenic
1113692651 13:112322638-112322660 AAGGCATTCAACGCGGCTGCAGG + Intergenic
1114917854 14:27289402-27289424 AAGAAATTCAACCCAGCTGCAGG - Intergenic
1131508710 15:93037146-93037168 AATGCATGCAGCGCGGCGGCCGG - Intronic
1139367735 16:66444029-66444051 AGGGCATTCAACCTGGCTGGAGG + Intronic
1163576718 19:18115215-18115237 AAGGCCTTCACCGTGGCAGCAGG + Intronic
1167421088 19:49403774-49403796 AAGGCACTCAACCTGGCAGCAGG - Intronic
1167476875 19:49706355-49706377 TAGGCATCCAACGACGCTGCCGG - Exonic
926611999 2:14956264-14956286 AAGCCATTCAACGAGTCTCCAGG + Intergenic
940444665 2:153764002-153764024 AAGGCATTCAACAAGTCTGTAGG - Intergenic
1173367913 20:42404292-42404314 AAGGCATTCAAGTCCCCTGCAGG - Intronic
1175045119 20:56097656-56097678 AAAGCATTTAACTCGGCAGCTGG - Intergenic
1184986818 22:48141466-48141488 ACTGCGTTCAACACGGCTGCAGG + Intergenic
953578530 3:44132806-44132828 AATGCATTCAAAGCTGCTGCGGG - Intergenic
955703290 3:61703507-61703529 AAGGCATTCCACAGGGCTGGGGG + Intronic
957916799 3:86696151-86696173 AAGGCGATTAACGAGGCTGCCGG - Intergenic
973001844 4:44961487-44961509 CAGGCATTCAAAGCATCTGCTGG - Intergenic
976503225 4:85815636-85815658 AAGCCATTCAACGAGTCTGTAGG + Intronic
983918179 4:173314804-173314826 GAGGCATACAGCGGGGCTGCAGG - Intronic
988227037 5:28426160-28426182 GAGGAATTCAAGCCGGCTGCAGG + Intergenic
994016123 5:94967441-94967463 AAGTCATACAACTAGGCTGCTGG + Intronic
996124525 5:119708627-119708649 AAGGCATGCACTGCAGCTGCTGG - Intergenic
997791504 5:136766408-136766430 AAGACATTCAACACTGCTGGAGG - Intergenic
1013060108 6:106625368-106625390 AAGACATTCAATGCTGCTGACGG + Intronic
1017387893 6:153907341-153907363 AAGCCATTCAACAAGTCTGCAGG - Intergenic
1035341117 7:158162810-158162832 CAGTCAGTCAACGAGGCTGCGGG - Intronic
1041464632 8:58146192-58146214 AGAGCATCCAACACGGCTGCCGG + Exonic
1047194766 8:122711641-122711663 AAGCCATTCAACGAGTCTGTAGG - Intergenic
1053438527 9:38094482-38094504 AAGGCATTCAGCACAGCTCCTGG + Intergenic
1053619593 9:39802070-39802092 AAGACATTCAACTCAGCTGCAGG + Intergenic
1053877763 9:42561386-42561408 AAGACATTCAACTCAGCTGCAGG + Intergenic
1053894893 9:42732980-42733002 AAGACATTCAACTCAGCTGCAGG - Intergenic
1054233930 9:62540308-62540330 AAGACATTCAACTCAGCTGCAGG - Intergenic
1054264565 9:62905373-62905395 AAGACATTCAACTCAGCTGCAGG - Intergenic
1055915894 9:81399865-81399887 AAGGCATTTAAAGCAGCTCCTGG - Intergenic
1056396505 9:86186256-86186278 AAGGCATTCCAAGGGGCTTCAGG + Intergenic
1188041604 X:25375855-25375877 AAGGCATTCAACAAGTCTCCGGG - Intergenic
1189815686 X:44822408-44822430 AAGCCATTCAACAAGTCTGCAGG - Intergenic
1192759296 X:74078506-74078528 AATGTATTCACGGCGGCTGCTGG - Intergenic
1196472034 X:116039585-116039607 ATGGTATTCAAATCGGCTGCTGG - Intergenic
1196546943 X:116974246-116974268 AAGAAATTCAACCCTGCTGCAGG + Intergenic