ID: 1113693615

View in Genome Browser
Species Human (GRCh38)
Location 13:112329179-112329201
Sequence CAGGGTGGACAGAAGGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113693615_1113693622 4 Left 1113693615 13:112329179-112329201 CCTGGGTCCTTCTGTCCACCCTG No data
Right 1113693622 13:112329206-112329228 ACACAGGAGCATGACCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113693615 Original CRISPR CAGGGTGGACAGAAGGACCC AGG (reversed) Intergenic
No off target data available for this crispr