ID: 1113695047

View in Genome Browser
Species Human (GRCh38)
Location 13:112339379-112339401
Sequence AATGATTAGCTGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113695044_1113695047 25 Left 1113695044 13:112339331-112339353 CCAGTAAAAGAAAGAGTCGCACA No data
Right 1113695047 13:112339379-112339401 AATGATTAGCTGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113695047 Original CRISPR AATGATTAGCTGAAGGAGGA AGG Intergenic
No off target data available for this crispr