ID: 1113695422

View in Genome Browser
Species Human (GRCh38)
Location 13:112342638-112342660
Sequence TCCCTCCGGGGGGCCAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113695422_1113695434 -2 Left 1113695422 13:112342638-112342660 CCCTCCCTGGCCCCCCGGAGGGA No data
Right 1113695434 13:112342659-112342681 GAGTGGGGCCCTGAGACGCCTGG No data
1113695422_1113695438 29 Left 1113695422 13:112342638-112342660 CCCTCCCTGGCCCCCCGGAGGGA No data
Right 1113695438 13:112342690-112342712 CTTCTGACCCCAGAACTTTGAGG No data
1113695422_1113695439 30 Left 1113695422 13:112342638-112342660 CCCTCCCTGGCCCCCCGGAGGGA No data
Right 1113695439 13:112342691-112342713 TTCTGACCCCAGAACTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113695422 Original CRISPR TCCCTCCGGGGGGCCAGGGA GGG (reversed) Intergenic
No off target data available for this crispr