ID: 1113698749

View in Genome Browser
Species Human (GRCh38)
Location 13:112366951-112366973
Sequence CTCCCTTGTCACCATCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113698749_1113698755 24 Left 1113698749 13:112366951-112366973 CCACCAGGATGGTGACAAGGGAG No data
Right 1113698755 13:112366998-112367020 CACCCCCCCCAGCAGTCATGAGG No data
1113698749_1113698754 -8 Left 1113698749 13:112366951-112366973 CCACCAGGATGGTGACAAGGGAG No data
Right 1113698754 13:112366966-112366988 CAAGGGAGGCAGCAGGAAGTGGG No data
1113698749_1113698753 -9 Left 1113698749 13:112366951-112366973 CCACCAGGATGGTGACAAGGGAG No data
Right 1113698753 13:112366965-112366987 ACAAGGGAGGCAGCAGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113698749 Original CRISPR CTCCCTTGTCACCATCCTGG TGG (reversed) Intergenic